National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11759R-1 
 Symbol Kap3  Full Name Kinesin associated protein 3 
 CG No CG11759  Old CG No CG11759 
 Synonyms CG11759, DmKap, KAP3, Kap, DmKAP, dKAP3, Kap3, Kinesin associated protein 3, Kinesin II accessory protein 
 Accession No (Link to NCBI) NM_167278.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Perkins AD, Lee MJ, Tanentzapf G.
The systematic identification of cytoskeletal genes required for Drosophila melanogaster muscle maintenance.
Sci Data (2014) 1 140002 [ PubMed ID = 25977760 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ACTCCGTTCGCTGAACGCCAAAACGGATCCGGCTGCCTTGGCACGAGAAGTGGTGGAGAA 60

                           ||| ||||||||||||||||||||||| ||||||||||||||||||||||| |||||||| silico     61  GTGCGATCTCATCCACAAGTCCCAGCTTAATGACGTCGAGCAGATAATCTTTTATCTGAA 120

                           |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| silico     121 GAATCGCAAGGATAATGCAAGCAATGATATACCGGATAACAACACTCACAGCCGGCGATC 180

                           | |||| ||||||||| |||||||| |||||||||||||||||||||||||||||||||| silico     181 G-GCGGCGCTGCACACTTCGCACAC-CCGCTCCTCTGCTCGATCGCACAGCAGTGTGGCG 240

                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| silico     241 GCCATGACCAGCAGCACCGGCAGCGGCGGAGGATCCACTGGAGCTAGCAATGGTGTCTCG 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| silico     301 AATGCCCTGAGTGCCGCCACGCCCACGGCGGATGTGTCCATAAACAATATCGATGAGTAT 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GTGGAGCTGCTGTACGAGGAGCTGGGCGAACGCATTCGAGGCTCGGCCATGATCCTACAG 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 ATGGCGCGAAATCCCGATAATCTTGAAGAGCTGGAAAAGAATGAAGCCTGCCTCAGCGCC 480

11759R-1.IR_full       481 TTGTCACGTGTTCTGCGCGAGG 502
                           |||||||||||||||||||||| silico     481 TTGTCACGTGTTCTGCGCGAGG 502

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_167278.1  CG11759-RA (Kap3), mRNA 
0   NM_132457.1  CG11122-RA (CG11122), mRNA 
0   NM_078614.3  CG8544-RB, transcript variant B (sd), mRNA 
0   NM_167465.1  CG8544-RA, transcript variant A (sd), mRNA 
0   NM_206727.1  CG8544-RC, transcript variant C (sd), mRNA 
0   NM_143436.1  CG2006-RA (CG2006), mRNA 
0   NM_166229.2  CG14478-RA, transcript variant A (CG14478), mRNA 
0   NM_137370.3  CG14478-RB, transcript variant B (CG14478), mRNA 
0   NM_130642.1  CG14050-RA (CG14050), mRNA 
0   11  NM_001031888.1  CG33691-RB, transcript variant B (CG33691), mRNA 
0   11  NM_001031885.1  CG33692-RB, transcript variant B (CG33692), mRNA 
0   NM_001031887.1  CG33691-RC, transcript variant C (CG33691), mRNA 
0   NM_001031889.1  CG33691-RA, transcript variant A (CG33691), mRNA 
0   NM_001031886.1  CG33692-RA, transcript variant A (CG33692), mRNA 
0   NM_001031884.1  CG33692-RC, transcript variant C (CG33692), mRNA 
0   NM_206056.2  CG8715-RC, transcript variant C (lig), mRNA 
0   NM_136504.3  CG8715-RA, transcript variant A (lig), mRNA 
0   NM_165586.2  CG8715-RB, transcript variant B (lig), mRNA 
0   NM_001014503.1  CG8715-RD, transcript variant D (lig), mRNA 
0   NM_168290.1  CG5939-RB, transcript variant B (Prm), mRNA 
0   NM_168292.1  CG5939-RD, transcript variant D (Prm), mRNA 
0   NM_168291.1  CG5939-RC, transcript variant C (Prm), mRNA 
0   NM_079258.2  CG5939-RA, transcript variant A (Prm), mRNA 
0   NM_136425.2  CG11107-RA (CG11107), mRNA 
0   NM_057245.2  CG6189-RA (l(1)1Bi), mRNA 
0   NM_130715.2  CG13316-RB, transcript variant B (Mnt), mRNA 
0   NM_166984.1  CG13316-RC, transcript variant C (Mnt), mRNA 
0   NM_166983.1  CG13316-RA, transcript variant A (Mnt), mRNA 
0   NM_001015271.1  CG40368-PB.3 (CG40368), mRNA 
0   NM_135094.2  CG6957-RA, transcript variant A (Oscillin), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.