National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11757R-1 
 Symbol CG34348  Full Name
 CG No CG34348  Old CG No CG11757 
 Synonyms FBgn0085377, CG11757, CG15197, CG34348 
 Accession No (Link to NCBI) NM_132478.1 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Comment balanced with SM6a, Cy 
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCCATTTGGGATGCACATGCT 
 Primer Seq. 3'
aatctagaggtaccACCGGTATGCGCACCTTATTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GCCATTTGGG ATGCACATGC TCGGATCTAT CATGGCTACG AGGTGATCGG ATTGGAGAAT 
0061 GTGCCACAGG AGGGACCGGC GCTGATTGTC TACTATCATG GCGCCATACC CATCGATATG 
0121 TACTACTTGA ATTCGCGAAT GTTGCTGCAG CGCGAGCGTT TGATCTACAC GATCGGCGAT 
0181 CGATTTCTGT TCAAGCTGCC CGGCTGGGGC ACCATTTCGG AGGCATTCCA CGTCAGTCCC 
0241 GGCACGGTGC AGTCGTGCGT TAGCATTTTA CGGGATGGCA ATCTGCTGGC CATTTCGCCG 
0301 GGCGGCGTTT ATGAGGCACA GTTCGGTGAT CACTACTACG AGCTGTTGTG GCGCAATCGT 
0361 GTCGGTTTCG CCAAGGTGGC CATTGAGGCA AAGGCGCCCA TCATTCCCTG CTTTACGCAG 
0421 AATCTGCGCG AGGGCTTCCG TCAGGTGGGC ATCTTTCGGA CGTTCTTCAT GCGACTGTAC 
0481 AATAAGGTGC GCATACCAGT GGT 
 in silico PCR Fragment
0001 GCCATTTGGG ATGCACATGC TCGGATCTAT CATGGCTACG AGGTGATCGG ATTGGAGAAT 
0061 GTGCCACAGG AGGGACCGGC GCTGATTGTC TACTATCATG GCGCCATACC CATCGATATG 
0121 TACTACTTGA ATTCGCGAAT GTTGCTGCAG CGCGAGCGTT TGATCTACAC GATCGGCGAT 
0181 CGATTTCTGT TCAAGCTGCC CGGCTGGGGC ACCATCTCTG AGGCATTCCA CGTCAGTCCC 
0241 GGCACGGTGC AGTCGTGCGT TAGCATTTTG CGGGATGGCA ATCTGCTGGC CATTTCGCCG 
0301 GGCGGCGTTT ATGAGGCACA GTTCGGTGAT CACTACTACG AGCTGTTGTG GCGCAATCGT 
0361 GTCGGTTTCG CCAAGGTGGC CATCGAGGCA AAGGCGCCCA TCATTCCCTG CTTTACGCAG 
0421 AATCTGCGCG AGGGCTTCCG TCAGGTGGGC ATCTTTCGGA CGTTCTTCAT GCGACTGTAC 
0481 AATAAGGTGC GCATACC--- GGT 
 Assemble Data

11757R-1.IR_full       1   GCCATTTGGGATGCACATGCTCGGATCTATCATGGCTACGAGGTGATCGGATTGGAGAAT 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11757R-1.in silico     1   GCCATTTGGGATGCACATGCTCGGATCTATCATGGCTACGAGGTGATCGGATTGGAGAAT 60


11757R-1.IR_full       61  GTGCCACAGGAGGGACCGGCGCTGATTGTCTACTATCATGGCGCCATACCCATCGATATG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11757R-1.in silico     61  GTGCCACAGGAGGGACCGGCGCTGATTGTCTACTATCATGGCGCCATACCCATCGATATG 120


11757R-1.IR_full       121 TACTACTTGAATTCGCGAATGTTGCTGCAGCGCGAGCGTTTGATCTACACGATCGGCGAT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11757R-1.in silico     121 TACTACTTGAATTCGCGAATGTTGCTGCAGCGCGAGCGTTTGATCTACACGATCGGCGAT 180


11757R-1.IR_full       181 CGATTTCTGTTCAAGCTGCCCGGCTGGGGCACCATTTCGGAGGCATTCCACGTCAGTCCC 240
                           ||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||
11757R-1.in silico     181 CGATTTCTGTTCAAGCTGCCCGGCTGGGGCACCATCTCTGAGGCATTCCACGTCAGTCCC 240


11757R-1.IR_full       241 GGCACGGTGCAGTCGTGCGTTAGCATTTTACGGGATGGCAATCTGCTGGCCATTTCGCCG 300
                           ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
11757R-1.in silico     241 GGCACGGTGCAGTCGTGCGTTAGCATTTTGCGGGATGGCAATCTGCTGGCCATTTCGCCG 300


11757R-1.IR_full       301 GGCGGCGTTTATGAGGCACAGTTCGGTGATCACTACTACGAGCTGTTGTGGCGCAATCGT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11757R-1.in silico     301 GGCGGCGTTTATGAGGCACAGTTCGGTGATCACTACTACGAGCTGTTGTGGCGCAATCGT 360


11757R-1.IR_full       361 GTCGGTTTCGCCAAGGTGGCCATTGAGGCAAAGGCGCCCATCATTCCCTGCTTTACGCAG 420
                           ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
11757R-1.in silico     361 GTCGGTTTCGCCAAGGTGGCCATCGAGGCAAAGGCGCCCATCATTCCCTGCTTTACGCAG 420


11757R-1.IR_full       421 AATCTGCGCGAGGGCTTCCGTCAGGTGGGCATCTTTCGGACGTTCTTCATGCGACTGTAC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11757R-1.in silico     421 AATCTGCGCGAGGGCTTCCGTCAGGTGGGCATCTTTCGGACGTTCTTCATGCGACTGTAC 480


11757R-1.IR_full       481 AATAAGGTGCGCATACCAGTGGT 503
                           |||||||||||||||||   |||
11757R-1.in silico     481 AATAAGGTGCGCATACC---GGT 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_132478.1  CG11757-RA (CG11757), mRNA 
0   NM_079159.2  CG1004-RA (rho), mRNA 
0   NM_137787.1  CG13501-RA (CG13501), mRNA 
0   NM_001032080.1  CG33695-RA, transcript variant A (CG33695), mRNA 
0   NM_001032076.1  CG33694-RA, transcript variant A (cana), mRNA 
0   NM_141603.1  CG11983-RA (CG11983), mRNA 
0   NM_080341.2  CG12737-RA, transcript variant A (Crag), mRNA 
0   NM_167164.2  CG12737-RB, transcript variant B (Crag), mRNA 
0   NM_057450.3  CG9704-RB, transcript variant B (Nrt), mRNA 
0   NM_168682.1  CG9704-RA, transcript variant A (Nrt), mRNA 
0   NM_165849.1  CG8983-RA, transcript variant A (ERp60), mRNA 
0   NM_136866.2  CG8983-RB, transcript variant B (ERp60), mRNA 
0   NM_168829.1  CG7433-RB, transcript variant B (CG7433), mRNA 
0   NM_140911.2  CG7433-RA, transcript variant A (CG7433), mRNA 
0   NM_001031901.1  CG14209-RC, transcript variant C (Shawn), mRNA 
0   NM_001031902.1  CG14209-RB, transcript variant B (Shawn), mRNA 
0   NM_134483.2  CG14208-RB, transcript variant B (Tyler), mRNA 
0   NM_167671.1  CG14208-RA, transcript variant A (Tyler), mRNA 
0   NM_001031900.1  CG14209-RD, transcript variant D (Shawn), mRNA 
0   NM_167535.1  CG9676-RA (CG9676), mRNA 
0   NM_139683.1  CG7499-RA (Rh50), mRNA 
0   NM_168379.1  CG32050-RA (CG32050), mRNA 
0   NM_132788.2  CG9114-RA (CG9114), mRNA 
0   NM_134517.2  CG15618-RA (CG15618), mRNA 
0   NM_132789.2  CG6170-RA, transcript variant A (HDAC6), mRNA 
0   NM_133089.2  CG6659-RA, transcript variant A (CG6659), mRNA 
0   NM_167627.1  CG6659-RB, transcript variant B (CG6659), mRNA 
0   NM_132207.2  CG1571-RA (CG1571), mRNA 
0   NM_079316.2  CG4237-RA (Gap69C), mRNA 
0   NM_135823.2  CG7311-RA, transcript variant A (CG7311), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.