National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11756R-1 
 Symbol CG11756  Full Name CG11756 
 CG No CG11756  Old CG No CG11756 
 Synonyms BcDNA:AT06648, CG11756 
 Accession No (Link to NCBI) NM_132480.1 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACTACGCGAATGGTCGCTACA 
 Primer Seq. 3'
aatctagaggtaccGGCAAACAAATCGCTTTCCAG 
 Predicted Fragment Size
499 
 IR fragment full Seq
0001 ACTACGCGAA TGGTCGCTAC AGGATTCCGC ATCCGAAGAA GCTGGCCGCC AgGCGAAAGT 
0061 CGCCCCCGGT GAATATATCC ACGAGGAGCG TCATCAATGG CGGCAGGTCG GCAAACGGGA 
0121 GGCTCAAGAC GGAAAATAGA AACGCACGGC GACGTCGAGA GGGCAATCCA CATCTGACGC 
0181 GACCACACAG CCGATCCTCC CAGAAAACCA TAGGGATCCG CCTGGATCCC ATTAGCTACA 
0241 TCGTAAATGT GCCCAATTCC ACTTCATCGC CCGACGACGA CGAGGAGGAG GTGCCTGTAC 
0301 CGCAATTGCC CAACGCAGTA AACAAACTGA AGGCTCGAAC GTATCGGAAG GAGAATTCCG 
0361 ATTGCCTTAT TCCACCGCCA GTTAGTCGCG TCGCGAGTTG GTCGGGTCCT TTGAATGCCA 
0421 GTCCCTTCAA CCAGCTGGAT GAGCAGAATT CCATCGCTGA CGATGCGGAC GCAATGGGCT 
0481 GGAAAGCGAT TTGTTTGCC 
 in silico PCR Fragment
0001 ACTACGCGAA TGGTCGCTAC AGGATTCCGC ATCCGAAGAA GCTGGCCGCC AGGCGAAAGT 
0061 CGCCCCCGGT GAATATATCC ACGAGGAGCG TCATCAATGG CGGCAGGTCG GCAAACGGGA 
0121 GGCTCAAGAC GGAAAATAGA AACGCACGGC GACGTCGAGA GGGCAATCCA CATCTGACGC 
0181 GACCACACAG CCGATCCTCC CAGAAAACCA TAGGGATCCG CCTGGATCCC ATTAGCTACA 
0241 TCGTAAATGT GCCCAATTCC ACTTCATCGC CCGACGACGA CGAGGAGGAG GTGCCTGTAC 
0301 CGCAATTGCC CAACGCAGTA AACAAACTGA AGGCTCGAAC GTATCGGAAG GAGAATTCCG 
0361 ATTGCCTTAT TCCACCGCCA GTTAGTCGCG TCGCGAGTTG GTCGGGTCCT TTGAATGCCA 
0421 GTCCCTTCAA CCAGCTGGAT GAGCAGAATT CCATCTCTGA CGATGCGGAC GCAATGGGCT 
0481 GGAAAGCGAT TTGTTTGCC 
 Assemble Data

11756R-1.IR_full       1   ACTACGCGAATGGTCGCTACAGGATTCCGCATCCGAAGAAGCTGGCCGCCAGGCGAAAGT 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11756R-1.in silico     1   ACTACGCGAATGGTCGCTACAGGATTCCGCATCCGAAGAAGCTGGCCGCCAGGCGAAAGT 60


11756R-1.IR_full       61  CGCCCCCGGTGAATATATCCACGAGGAGCGTCATCAATGGCGGCAGGTCGGCAAACGGGA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11756R-1.in silico     61  CGCCCCCGGTGAATATATCCACGAGGAGCGTCATCAATGGCGGCAGGTCGGCAAACGGGA 120


11756R-1.IR_full       121 GGCTCAAGACGGAAAATAGAAACGCACGGCGACGTCGAGAGGGCAATCCACATCTGACGC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11756R-1.in silico     121 GGCTCAAGACGGAAAATAGAAACGCACGGCGACGTCGAGAGGGCAATCCACATCTGACGC 180


11756R-1.IR_full       181 GACCACACAGCCGATCCTCCCAGAAAACCATAGGGATCCGCCTGGATCCCATTAGCTACA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11756R-1.in silico     181 GACCACACAGCCGATCCTCCCAGAAAACCATAGGGATCCGCCTGGATCCCATTAGCTACA 240


11756R-1.IR_full       241 TCGTAAATGTGCCCAATTCCACTTCATCGCCCGACGACGACGAGGAGGAGGTGCCTGTAC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11756R-1.in silico     241 TCGTAAATGTGCCCAATTCCACTTCATCGCCCGACGACGACGAGGAGGAGGTGCCTGTAC 300


11756R-1.IR_full       301 CGCAATTGCCCAACGCAGTAAACAAACTGAAGGCTCGAACGTATCGGAAGGAGAATTCCG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11756R-1.in silico     301 CGCAATTGCCCAACGCAGTAAACAAACTGAAGGCTCGAACGTATCGGAAGGAGAATTCCG 360


11756R-1.IR_full       361 ATTGCCTTATTCCACCGCCAGTTAGTCGCGTCGCGAGTTGGTCGGGTCCTTTGAATGCCA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11756R-1.in silico     361 ATTGCCTTATTCCACCGCCAGTTAGTCGCGTCGCGAGTTGGTCGGGTCCTTTGAATGCCA 420


11756R-1.IR_full       421 GTCCCTTCAACCAGCTGGATGAGCAGAATTCCATCGCTGACGATGCGGACGCAATGGGCT 480
                           ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
11756R-1.in silico     421 GTCCCTTCAACCAGCTGGATGAGCAGAATTCCATCTCTGACGATGCGGACGCAATGGGCT 480


11756R-1.IR_full       481 GGAAAGCGATTTGTTTGCC 499
                           |||||||||||||||||||
11756R-1.in silico     481 GGAAAGCGATTTGTTTGCC 499

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   481  NM_132480.1  CG11756-RA (CG11756), mRNA 
0.41   11  15  NM_167309.1  CG32663-RA (CG32663), mRNA 
0.41   11  NM_139540.1  CG14960-RA (CG14960), mRNA 
0.41   10  NM_141549.1  CG8007-RB, transcript variant B (CG8007), mRNA 
0.41   14  NM_079007.2  CG17716-RA (fas), mRNA 
0.41   16  NM_141571.2  CG8223-RA (CG8223), mRNA 
0.2   12  NM_143338.2  CG12259-RA (CG12259), mRNA 
0.2   11  16  NM_131987.2  CG4202-RA (Sas10), mRNA 
0.2   NM_170568.1  CG1856-RF, transcript variant F (ttk), mRNA 
0.2   NM_080172.2  CG1856-RC, transcript variant C (ttk), mRNA 
0.2   NM_170567.1  CG1856-RD, transcript variant D (ttk), mRNA 
0.2   12  NM_130554.2  CG11448-RA (CG11448), mRNA 
0.2   18  NM_206438.1  CG17603-RB, transcript variant B (Taf1), mRNA 
0.2   18  NM_206437.1  CG17603-RC, transcript variant C (Taf1), mRNA 
0.2   18  NM_057608.4  CG17603-RA, transcript variant A (Taf1), mRNA 
0.2   NM_079453.2  CG6975-RA (gig), mRNA 
0.2   11  NM_137496.1  CG5226-RA (CG5226), mRNA 
0   NM_132429.2  CG2202-RA (CG2202), mRNA 
0   10  13  NM_131978.1  CG15465-RA (CG15465), mRNA 
0   10  NM_137247.1  CG8434-RA (lbk), mRNA 
0   17  NM_001014453.1  CG33526-RD, transcript variant D (PNUTS), mRNA 
0   17  NM_001014452.1  CG33526-RC, transcript variant C (PNUTS), mRNA 
0   17  NM_001014455.1  CG33526-RB, transcript variant B (PNUTS), mRNA 
0   17  NM_001014454.1  CG33526-RA, transcript variant A (PNUTS), mRNA 
0   12  NM_134490.2  CG12238-RA (l(1)G0084), mRNA 
0   NM_001014624.1  CG33555-RC, transcript variant C (btsz), mRNA 
0   NM_078606.3  CG6146-RA, transcript variant A (Top1), mRNA 
0   NM_001014742.1  CG6146-RC, transcript variant C (Top1), mRNA 
0   10  19  NM_141129.1  CG11523-RA (CG11523), mRNA 
0   NM_136147.2  CG10364-RA (msb1l), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.