National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11658R-2 
 Symbol CG11658  Full Name CG11658 
 CG No CG11658  Old CG No CG11658 
 Synonyms anon-WO0118547.413, CG11658 
 Accession No (Link to NCBI) NM_140241.2 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Chen ZS, Wong AKY, Cheng TC, Koon AC, Chan HYE.
FipoQ/FBXO33, a Cullin-1 based ubiquitin ligase complex component modulates ubiquitination and solubility of polyglutamine disease protein.
J. Neurochem. (2019) [ PubMed ID = 30685895 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGATCAAAACCGATGGCGGCT 
 Primer Seq. 3'
aatctagaggtaccGCGCTTGATGGTGGCCATGTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GGATCAAAAC CGATGGCGGC TGGGAGCGTT CCAAGGTGCT CGAGTGCGGC GGAAAGCGGA 
0061 AGCGGCACCA TTCAGAGGGC AGCAGCAGCT ACCAGGACAG CGACAGTTCG GAGGAGGAGG 
0121 CGGTGATGCC GCCGCATTAT CACATCACCA TCCGGTGTAC CAGAGAGATA GCCGGGTTTA 
0181 ATGGTCTCAG TGAGGCTGTG AAGCGTCTGG ATTTCAGGCG ATCTGTGCGG GATCGCAAGC 
0241 GGTTCCACTA CATATGCGCC TTCCTGCTGC TCGTGTCCAA CAAGGGTATT GCCAGTCTGC 
0301 CAGGCAGTGC TCAGCGCCAN CTACTCCAAA TGGTCGAGGA GGTGGCCTCG CATGTAAATG 
0361 ACAGCCAGCA GCATCCGAAt gTNNNGCGCg GCCTGGNCCT GAAGCTGGAG CACATTGTCA 
0421 GCCAAGAGAA CCAGAAGTGC TGGGGCAAGC CGCTGGGCAG CACGTACCTG TGGAAGGAGC 
0481 ACATGGCCAC CATCAAGNGN  
 in silico PCR Fragment
0001 GGATCAAAAC CGATGGCGGC TGGGAGCGTT CCAAGGTGCT CGAGTGCGGC GGAAAGCGGA 
0061 AGCGGCACCA TTCAGAGGGC AGCAGCAGCT ACCAGGACAG CGACAGTTCG GAGGAGGAGG 
0121 CGGTGATGCC GCCGCATTAT CACATCACCA TCCGGTGTAC CAGAGAGATA GCCGGGTTTA 
0181 ATGGTCTCAG TGAGGCTGTG AAGCGTCTGG ATTTCAGGCG ATCTGTGCGG GATCGCAAGC 
0241 GGTTCCACTA CATATGCGCC TTCCTGCTGC TCGTGTCCAA CAAGGGTATT GCCAGTCTGC 
0301 CAGGCAGTGC TCAGCGCCAG CTACTCCAAA TGGTCGAGGA GGTGGCCTCG CATGTAAATG 
0361 ACAGCCAGCA GCATCCGAAT GTGCTGCGCG GCCTGGCCCT GAAGCTGGAG CACATTGTCA 
0421 GCCAAGAGAA CCAGAAGTGC TGGGGCAAGC CGCTGGGCAG CACGTACCTG TGGAAGGAGC 
0481 ACATGGCCAC CATCAAGCGC  
 Assemble Data

11658R-2.IR_full       1   GGATCAAAACCGATGGCGGCTGGGAGCGTTCCAAGGTGCTCGAGTGCGGCGGAAAGCGGA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11658R-2.in silico     1   GGATCAAAACCGATGGCGGCTGGGAGCGTTCCAAGGTGCTCGAGTGCGGCGGAAAGCGGA 60


11658R-2.IR_full       61  AGCGGCACCATTCAGAGGGCAGCAGCAGCTACCAGGACAGCGACAGTTCGGAGGAGGAGG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11658R-2.in silico     61  AGCGGCACCATTCAGAGGGCAGCAGCAGCTACCAGGACAGCGACAGTTCGGAGGAGGAGG 120


11658R-2.IR_full       121 CGGTGATGCCGCCGCATTATCACATCACCATCCGGTGTACCAGAGAGATAGCCGGGTTTA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11658R-2.in silico     121 CGGTGATGCCGCCGCATTATCACATCACCATCCGGTGTACCAGAGAGATAGCCGGGTTTA 180


11658R-2.IR_full       181 ATGGTCTCAGTGAGGCTGTGAAGCGTCTGGATTTCAGGCGATCTGTGCGGGATCGCAAGC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11658R-2.in silico     181 ATGGTCTCAGTGAGGCTGTGAAGCGTCTGGATTTCAGGCGATCTGTGCGGGATCGCAAGC 240


11658R-2.IR_full       241 GGTTCCACTACATATGCGCCTTCCTGCTGCTCGTGTCCAACAAGGGTATTGCCAGTCTGC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11658R-2.in silico     241 GGTTCCACTACATATGCGCCTTCCTGCTGCTCGTGTCCAACAAGGGTATTGCCAGTCTGC 300


11658R-2.IR_full       301 CAGGCAGTGCTCAGCGCCANCTACTCCAAATGGTCGAGGAGGTGGCCTCGCATGTAAATG 360
                           ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
11658R-2.in silico     301 CAGGCAGTGCTCAGCGCCAGCTACTCCAAATGGTCGAGGAGGTGGCCTCGCATGTAAATG 360


11658R-2.IR_full       361 ACAGCCAGCAGCATCCGAATGTNNNGCGCGGCCTGGNCCTGAAGCTGGAGCACATTGTCA 420
                           ||||||||||||||||||||||   ||||||||||| |||||||||||||||||||||||
11658R-2.in silico     361 ACAGCCAGCAGCATCCGAATGTGCTGCGCGGCCTGGCCCTGAAGCTGGAGCACATTGTCA 420


11658R-2.IR_full       421 GCCAAGAGAACCAGAAGTGCTGGGGCAAGCCGCTGGGCAGCACGTACCTGTGGAAGGAGC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11658R-2.in silico     421 GCCAAGAGAACCAGAAGTGCTGGGGCAAGCCGCTGGGCAGCACGTACCTGTGGAAGGAGC 480


11658R-2.IR_full       481 ACATGGCCACCATCAAGNGN 500
                           ||||||||||||||||| | 
11658R-2.in silico     481 ACATGGCCACCATCAAGCGC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_206337.1  CG11658-RD, transcript variant D (CG11658), mRNA 
100   482  NM_206336.1  CG11658-RE, transcript variant E (CG11658), mRNA 
100   482  NM_140241.2  CG11658-RA, transcript variant A (CG11658), mRNA 
100   482  NM_206338.1  CG11658-RC, transcript variant C (CG11658), mRNA 
100   482  NM_206339.1  CG11658-RB, transcript variant B (CG11658), mRNA 
0.2   NM_167221.1  CG32689-RA (CG32689), mRNA 
0   NM_136895.2  CG13176-RA (CG13176), mRNA 
0   NM_132412.1  CG9817-RA (CG9817), mRNA 
0   NM_080015.2  CG5462-RD, transcript variant D (scrib), mRNA 
0   NM_170276.1  CG5462-RB, transcript variant B (scrib), mRNA 
0   NM_001014670.2  CG5462-RH, transcript variant H (scrib), mRNA 
0   NM_170275.1  CG5462-RA, transcript variant A (scrib), mRNA 
0   NM_001043296.1  CG5462-RG, transcript variant G (scrib), mRNA 
0   NM_001014669.1  CG5462-RI, transcript variant I (scrib), mRNA 
0   NM_134476.1  CG14218-RA (CG14218), mRNA 
0   NM_142737.1  CG17819-RA (CG17819), mRNA 
0   NM_143581.2  CG1715-RA (l(3)03670), mRNA 
0   11  NM_142330.1  CG5225-RA (CG5225), mRNA 
0   NM_001042839.1  CG40500-RB, transcript variant B (CG40500), mRNA 
0   NM_001042840.1  CG40500-RA, transcript variant A (CG40500), mRNA 
0   NM_001042841.1  CG40500-RD, transcript variant D (CG40500), mRNA 
0   NM_001042838.1  CG40500-RC, transcript variant C (CG40500), mRNA 
0   NM_135618.1  CG17137-RA (Porin2), mRNA 
0   NM_057557.3  CG9193-RA, transcript variant A (mus209), mRNA 
0   NM_206182.1  CG9193-RB, transcript variant B (mus209), mRNA 
0   NM_080362.2  CG31868-RA (Samuel), mRNA 
0   NM_205967.1  CG5442-RA, transcript variant A (SC35), mRNA 
0   NM_144355.2  CG5442-RB, transcript variant B (SC35), mRNA 
0   NM_001042834.1  CG41475-RA (CG41475), mRNA 
0   NM_142646.1  CG5483-RA (CG5483), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.