National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11658R-2 
 Symbol CG11658  Full Name CG11658 
 CG No CG11658  Old CG No CG11658 
 Synonyms anon-WO0118547.413, CG11658 
 Accession No (Link to NCBI) NM_140241.2 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Chen ZS, Wong AKY, Cheng TC, Koon AC, Chan HYE.
FipoQ/FBXO33, a Cullin-1-based ubiquitin ligase complex component modulates ubiquitination and solubility of polyglutamine disease protein.
J Neurochem (2019) 149(6) 781-798 [ PubMed ID = 30685895 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GGATCAAAACCGATGGCGGCTGGGAGCGTTCCAAGGTGCTCGAGTGCGGCGGAAAGCGGA 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  AGCGGCACCATTCAGAGGGCAGCAGCAGCTACCAGGACAGCGACAGTTCGGAGGAGGAGG 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CGGTGATGCCGCCGCATTATCACATCACCATCCGGTGTACCAGAGAGATAGCCGGGTTTA 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 ATGGTCTCAGTGAGGCTGTGAAGCGTCTGGATTTCAGGCGATCTGTGCGGGATCGCAAGC 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GGTTCCACTACATATGCGCCTTCCTGCTGCTCGTGTCCAACAAGGGTATTGCCAGTCTGC 300

                           ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| silico     301 CAGGCAGTGCTCAGCGCCAGCTACTCCAAATGGTCGAGGAGGTGGCCTCGCATGTAAATG 360

                           ||||||||||||||||||||||   ||||||||||| ||||||||||||||||||||||| silico     361 ACAGCCAGCAGCATCCGAATGTGCTGCGCGGCCTGGCCCTGAAGCTGGAGCACATTGTCA 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GCCAAGAGAACCAGAAGTGCTGGGGCAAGCCGCTGGGCAGCACGTACCTGTGGAAGGAGC 480

11658R-2.IR_full       481 ACATGGCCACCATCAAGNGN 500
                           ||||||||||||||||| | silico     481 ACATGGCCACCATCAAGCGC 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_206337.1  CG11658-RD, transcript variant D (CG11658), mRNA 
100   482  NM_206336.1  CG11658-RE, transcript variant E (CG11658), mRNA 
100   482  NM_140241.2  CG11658-RA, transcript variant A (CG11658), mRNA 
100   482  NM_206338.1  CG11658-RC, transcript variant C (CG11658), mRNA 
100   482  NM_206339.1  CG11658-RB, transcript variant B (CG11658), mRNA 
0.2   NM_167221.1  CG32689-RA (CG32689), mRNA 
0   NM_136895.2  CG13176-RA (CG13176), mRNA 
0   NM_132412.1  CG9817-RA (CG9817), mRNA 
0   NM_080015.2  CG5462-RD, transcript variant D (scrib), mRNA 
0   NM_170276.1  CG5462-RB, transcript variant B (scrib), mRNA 
0   NM_001014670.2  CG5462-RH, transcript variant H (scrib), mRNA 
0   NM_170275.1  CG5462-RA, transcript variant A (scrib), mRNA 
0   NM_001043296.1  CG5462-RG, transcript variant G (scrib), mRNA 
0   NM_001014669.1  CG5462-RI, transcript variant I (scrib), mRNA 
0   NM_134476.1  CG14218-RA (CG14218), mRNA 
0   NM_142737.1  CG17819-RA (CG17819), mRNA 
0   NM_143581.2  CG1715-RA (l(3)03670), mRNA 
0   11  NM_142330.1  CG5225-RA (CG5225), mRNA 
0   NM_001042839.1  CG40500-RB, transcript variant B (CG40500), mRNA 
0   NM_001042840.1  CG40500-RA, transcript variant A (CG40500), mRNA 
0   NM_001042841.1  CG40500-RD, transcript variant D (CG40500), mRNA 
0   NM_001042838.1  CG40500-RC, transcript variant C (CG40500), mRNA 
0   NM_135618.1  CG17137-RA (Porin2), mRNA 
0   NM_057557.3  CG9193-RA, transcript variant A (mus209), mRNA 
0   NM_206182.1  CG9193-RB, transcript variant B (mus209), mRNA 
0   NM_080362.2  CG31868-RA (Samuel), mRNA 
0   NM_205967.1  CG5442-RA, transcript variant A (SC35), mRNA 
0   NM_144355.2  CG5442-RB, transcript variant B (SC35), mRNA 
0   NM_001042834.1  CG41475-RA (CG41475), mRNA 
0   NM_142646.1  CG5483-RA (CG5483), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.