National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11628R-3 
 Symbol step  Full Name steppke 
 CG No CG11628  Old CG No CG11628 
 Synonyms CYH1, CG11628, cytohesin/GRP1, GRP1/cytohesin 1, CG11633, step, GPH, l(2)k08110, l(2)SH0323, l(2)SH2 0323, Grp1 
 Accession No (Link to NCBI)  
 Inserted Chr.
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees late pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGACGTTGCCCACTTTCTCTAT 
 Primer Seq. 3'
aatctagaggtaccTCGGGATTGAAGAAGGTGTGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

11628R-3.IR full       1   GACGTTGCCCACTTTCTCTATAAGGGAGAGGGACTAAATAAAACAGCCATTGGCGATTAC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11628R-3.in silico     1   GACGTTGCCCACTTTCTCTATAAGGGAGAGGGACTAAATAAAACAGCCATTGGCGATTAC 60


11628R-3.IR full       61  CTCGGCGAGAAAAACGATTTTAATGAGGATGTGCTTAAGGCTTTTGTGGCGCTTCACGAT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11628R-3.in silico     61  CTCGGCGAGAAAAACGATTTTAATGAGGATGTGCTTAAGGCTTTTGTGGCGCTTCACGAT 120


11628R-3.IR full       121 TTCACCAATCTCATTCTCGTACAAGCCCTCAGACAATTTCTGTGGTCGTTTCGCCTGCCC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11628R-3.in silico     121 TTCACCAATCTCATTCTCGTACAAGCCCTCAGACAATTTCTGTGGTCGTTTCGCCTGCCC 180


11628R-3.IR full       181 GGCGAGGCACAAAAGATCGATCGCATGATGGAGACCTTCGCACAGCGCTACTGTCAACTA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11628R-3.in silico     181 GGCGAGGCACAAAAGATCGATCGCATGATGGAGACCTTCGCACAGCGCTACTGTCAACTA 240


11628R-3.IR full       241 AATCCAGATATATTCACCAACACGGACACATGCTATGTGCTCAGCTTCGCAATTATAATG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11628R-3.in silico     241 AATCCAGATATATTCACCAACACGGACACATGCTATGTGCTCAGCTTCGCAATTATAATG 300


11628R-3.IR full       301 CTAAATACCTCACTACACAATCCATCTGTTAAAGACAAACCCACCGTTGATCAATTCATA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11628R-3.in silico     301 CTAAATACCTCACTACACAATCCATCTGTTAAAGACAAACCCACCGTTGATCAATTCATA 360


11628R-3.IR full       361 TCGATGAATCGTGGCATCAACAACGGCGGAGATTTGCCCCGTGGCCTGCTGGAATCCCTT 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11628R-3.in silico     361 TCGATGAATCGTGGCATCAACAACGGCGGAGATTTGCCCCGTGGCCTGCTGGAATCCCTT 420


11628R-3.IR full       421 TACGAGTCAATTCGAACAGAGCCATTTAAAATACCACAGGATGATGGAAATGATTTGATG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11628R-3.in silico     421 TACGAGTCAATTCGAACAGAGCCATTTAAAATACCACAGGATGATGGAAATGATTTGATG 480


11628R-3.IR full       481 CACACCTTCTTCAATCCCGA 500
                           ||||||||||||||||||||
11628R-3.in silico     481 CACACCTTCTTCAATCCCGA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.