National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11628R-1 
 Symbol step  Full Name steppke 
 CG No CG11628  Old CG No CG11628 
 Synonyms CYH1, CG11628, cytohesin/GRP1, GRP1/cytohesin 1, CG11633, step, GPH, l(2)k08110, l(2)SH0323, l(2)SH2 0323, Grp1 
 Accession No (Link to NCBI)  
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees late pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGACGTTGCCCACTTTCTCTAT 
 Primer Seq. 3'
aatctagaggtaccTCGGGATTGAAGAAGGTGTGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GACGTTGCCC ACTTTCTCTA TAAGGGAGAG GGACTAAATA AAACAGCCAT TGGCGATTAC 
0061 CTCGGCGAGA AAAACGATTT TAATGAGGAT GTGCTTAAGG CTTTTGTGGC GCTTCACGAT 
0121 TTCACCAATC TCATTCTCGT ACAAGCCCTC AGACAATTTC TGTGGTCGTT TCGCCTGCCC 
0181 GGCGAGGCAC AAAAGATCGA TCGCATGATG GAGACCTTCG CACAGCGCTA CTGTCAACTA 
0241 AATCCAGATA TATTCACCAA CACGGACACA TGCTATGTGC TCAGCTTCGC AATTATAATG 
0301 CTAAATACCT CACTACACAA TCCATCTGTT AAAGACAAAC CCACCGTTGA TCAATTCATA 
0361 TCGATGAATC GTGGCATCAA CAACGGCGGA GATTTGCCCC GTGGCCTGCT GGAATCCCTT 
0421 TACGAGTCAA TTCGAACAGA GCCATTTAAA ATACCACAGG ATGATGGAAA TGATTTGATG 
0481 CACACCTTCT TCAATCCCGA  
 in silico PCR Fragment
0001 GACGTTGCCC ACTTTCTCTA TAAGGGAGAG GGACTAAATA AAACAGCCAT TGGCGATTAC 
0061 CTCGGCGAGA AAAACGATTT TAATGAGGAT GTGCTTAAGG CTTTTGTGGC GCTTCACGAT 
0121 TTCACCAATC TCATTCTCGT ACAAGCCCTC AGACAATTTC TGTGGTCGTT TCGCCTGCCC 
0181 GGCGAGGCAC AAAAGATCGA TCGCATGATG GAGACCTTCG CACAGCGCTA CTGTCAACTA 
0241 AATCCAGATA TATTCACCAA CACGGACACA TGCTATGTGC TCAGCTTCGC AATTATAATG 
0301 CTAAATACCT CACTACACAA TCCATCTGTT AAAGACAAAC CCACCGTTGA TCAATTCATA 
0361 TCGATGAATC GTGGCATCAA CAACGGCGGA GATTTGCCCC GTGGCCTGCT GGAATCCCTT 
0421 TACGAGTCAA TTCGAACAGA GCCATTTAAA ATACCACAGG ATGATGGAAA TGATTTGATG 
0481 CACACCTTCT TCAATCCCGA  
 Assemble Data

11628R-1.IR full       1   GACGTTGCCCACTTTCTCTATAAGGGAGAGGGACTAAATAAAACAGCCATTGGCGATTAC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11628R-1.in silico     1   GACGTTGCCCACTTTCTCTATAAGGGAGAGGGACTAAATAAAACAGCCATTGGCGATTAC 60


11628R-1.IR full       61  CTCGGCGAGAAAAACGATTTTAATGAGGATGTGCTTAAGGCTTTTGTGGCGCTTCACGAT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11628R-1.in silico     61  CTCGGCGAGAAAAACGATTTTAATGAGGATGTGCTTAAGGCTTTTGTGGCGCTTCACGAT 120


11628R-1.IR full       121 TTCACCAATCTCATTCTCGTACAAGCCCTCAGACAATTTCTGTGGTCGTTTCGCCTGCCC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11628R-1.in silico     121 TTCACCAATCTCATTCTCGTACAAGCCCTCAGACAATTTCTGTGGTCGTTTCGCCTGCCC 180


11628R-1.IR full       181 GGCGAGGCACAAAAGATCGATCGCATGATGGAGACCTTCGCACAGCGCTACTGTCAACTA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11628R-1.in silico     181 GGCGAGGCACAAAAGATCGATCGCATGATGGAGACCTTCGCACAGCGCTACTGTCAACTA 240


11628R-1.IR full       241 AATCCAGATATATTCACCAACACGGACACATGCTATGTGCTCAGCTTCGCAATTATAATG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11628R-1.in silico     241 AATCCAGATATATTCACCAACACGGACACATGCTATGTGCTCAGCTTCGCAATTATAATG 300


11628R-1.IR full       301 CTAAATACCTCACTACACAATCCATCTGTTAAAGACAAACCCACCGTTGATCAATTCATA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11628R-1.in silico     301 CTAAATACCTCACTACACAATCCATCTGTTAAAGACAAACCCACCGTTGATCAATTCATA 360


11628R-1.IR full       361 TCGATGAATCGTGGCATCAACAACGGCGGAGATTTGCCCCGTGGCCTGCTGGAATCCCTT 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11628R-1.in silico     361 TCGATGAATCGTGGCATCAACAACGGCGGAGATTTGCCCCGTGGCCTGCTGGAATCCCTT 420


11628R-1.IR full       421 TACGAGTCAATTCGAACAGAGCCATTTAAAATACCACAGGATGATGGAAATGATTTGATG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11628R-1.in silico     421 TACGAGTCAATTCGAACAGAGCCATTTAAAATACCACAGGATGATGGAAATGATTTGATG 480


11628R-1.IR full       481 CACACCTTCTTCAATCCCGA 500
                           ||||||||||||||||||||
11628R-1.in silico     481 CACACCTTCTTCAATCCCGA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.