National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11586R-3 
 Symbol CG11586  Full Name CG11586 
 CG No CG11586  Old CG No CG11586 
 Synonyms CG11586 
 Accession No (Link to NCBI) NM_139624.2 
 Inserted Chr.
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ATGACGATGCGACCTGATGACCACCGAAGGAAATGGGACAAGAACGAGTACGAGAAGCTG 60

                           |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GCGGCG-GAGCGGCTGCTCAACCAGGTGGCACCCAAGGAAGAAGAACCCGTACAGCGGGA 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GAACCTCAAGCGACGCGACTATAAGGTGGACCTGGACAGCAAGCTGGGCAAGAGCGTTGT 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CATCAACAAGAACACACCCACCTCGCAATCCGGTGGCTATTACTGCAACGTTTGCGACTG 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CGTGGTCAAGGATTCCATCAACTTTCTGGACCACATCAATGGCAAGAAGCACCAGCGCAA 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TCTGGGCATGTCCATGAAGGTGGAGCGGAGCACCGTCGACCAGGTAAAGGAGCGCTTCCA 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GCAGAACAAGAAGAAGATGGAGGAGAAGCAGAAAGACTACGAGCTCGAGCGCCGCCTGCG 420

                           |||||||||||||||||||||||   |||||||||||||||||||||||||||||||||| silico     421 GGAGGCCAAGGAGGAGGAGGATC---GCTACAAGGAACACCGCAAGGAGAAGCGAAAAGA 480

11586R-3.IR_full       481 GNGGAAGCGCAAGG 494
                           | |||||||||||| silico     481 GCGGAAGCGCAAGG 494

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   472  NM_139624.2  CG11586-RA (CG11586), mRNA 
0.21   NM_135724.2  CG5427-RA (Oatp33Ea), mRNA 
0   11  NM_132430.2  CG11207-RA (feo), mRNA 
0   NM_170430.2  CG31037-RA (ca), mRNA 
0   28  NM_176556.1  CG33106-RA, transcript variant A (mask), mRNA 
0   28  NM_176557.1  CG33106-RB, transcript variant B (mask), mRNA 
0   NM_057956.2  CG10269-RA (D19A), mRNA 
0   NM_057450.3  CG9704-RB, transcript variant B (Nrt), mRNA 
0   NM_168682.1  CG9704-RA, transcript variant A (Nrt), mRNA 
0   11  NM_143713.2  CG2173-RA (Rs1), mRNA 
0   10  NM_167649.1  CG32533-RA (CG32533), mRNA 
0   NM_165581.1  CG11198-RB, transcript variant B (CG11198), mRNA 
0   NM_136498.1  CG11198-RA, transcript variant A (CG11198), mRNA 
0   NM_136443.2  CG1620-RA (CG1620), mRNA 
0   NM_141738.3  CG6303-RA (Bruce), mRNA 
0   NM_058119.3  CG18783-RA, transcript variant A (Kr-h1), mRNA 
0   NM_058118.3  CG18783-RB, transcript variant B (Kr-h1), mRNA 
0   11  NM_142487.1  CG7709-RA (CG7709), mRNA 
0   NM_130478.2  CG2995-RA (CG2995), mRNA 
0   NM_132200.1  CG1531-RB (CG1531), mRNA 
0   NM_141533.2  CG7459-RA (Ctr1B), mRNA 
0   NM_133061.2  CG32549-RD, transcript variant D (CG32549), mRNA 
0   NM_206785.1  CG32549-RF, transcript variant F (CG32549), mRNA 
0   NM_206787.1  CG32549-RA, transcript variant A (CG32549), mRNA 
0   NM_167615.1  CG32549-RC, transcript variant C (CG32549), mRNA 
0   NM_167614.1  CG32549-RE, transcript variant E (CG32549), mRNA 
0   NM_206786.1  CG32549-RB, transcript variant B (CG32549), mRNA 
0   NM_169138.1  CG31367-RA (CG31367), mRNA 
0   NM_170037.1  CG31151-RA, transcript variant A (wge), mRNA 
0   NM_001043281.1  CG31151-RC, transcript variant C (wge), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.