National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11586R-1 
 Symbol CG11586  Full Name CG11586 
 CG No CG11586  Old CG No CG11586 
 Synonyms CG11586 
 Accession No (Link to NCBI) NM_139624.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGACGATGCGACCTGATGAC 
 Primer Seq. 3'
aatctagaggtaccCCTTGCGCTTCCGCTCTTTTC 
 Predicted Fragment Size
490 
 IR fragment full Seq
0001 ATGACGATGC GACCTGATGA CCACCGAAGG AAATGGGACA AGAACGAGTA CGAGAAGCTG 
0061 GCGGCGCGAG CGGCTGCTCA ACCAGGTGGC ACCCAAGGAA GAAGAACCCG TACAGCGGGA 
0121 GAACCTCAAG CGACGCGACT ATAAGGTGGA CCTGGACAGC AAGCTGGGCA AGAGCGTTGT 
0181 CATCAACAAG AACACACCCA CCTCGCAATC CGGTGGCTAT TACTGCAACG TTTGCGACTG 
0241 CGTGGTCAAG GATTCCATCA ACTTTCTGGA CCACATCAAT GGCAAGAAGC ACCAGCGCAA 
0301 TCTGGGCATG TCCATGAAGG TGGAGCGGAG CACCGTCGAC CAGGTAAAGG AGCGCTTCCA 
0361 GCAGAACAAG AAGAAGATGG AGGAGAAGCA GAAAGACTAC GAGCTCGAGC GCCGCCTGCG 
0421 GGAGGCCAag gAGGAGGAGG ATCATTGCTA CAAGGAACAC CGCAAGGAGA AGCGAAAAGA 
0481 gNGGAAGCGC AAGG 
 in silico PCR Fragment
0001 ATGACGATGC GACCTGATGA CCACCGAAGG AAATGGGACA AGAACGAGTA CGAGAAGCTG 
0061 GCGGCG-GAG CGGCTGCTCA ACCAGGTGGC ACCCAAGGAA GAAGAACCCG TACAGCGGGA 
0121 GAACCTCAAG CGACGCGACT ATAAGGTGGA CCTGGACAGC AAGCTGGGCA AGAGCGTTGT 
0181 CATCAACAAG AACACACCCA CCTCGCAATC CGGTGGCTAT TACTGCAACG TTTGCGACTG 
0241 CGTGGTCAAG GATTCCATCA ACTTTCTGGA CCACATCAAT GGCAAGAAGC ACCAGCGCAA 
0301 TCTGGGCATG TCCATGAAGG TGGAGCGGAG CACCGTCGAC CAGGTAAAGG AGCGCTTCCA 
0361 GCAGAACAAG AAGAAGATGG AGGAGAAGCA GAAAGACTAC GAGCTCGAGC GCCGCCTGCG 
0421 GGAGGCCAAG GAGGAGGAGG ATC---GCTA CAAGGAACAC CGCAAGGAGA AGCGAAAAGA 
0481 GCGGAAGCGC AAGG 
 Assemble Data

11586R-1.IR_full       1   ATGACGATGCGACCTGATGACCACCGAAGGAAATGGGACAAGAACGAGTACGAGAAGCTG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11586R-1.in silico     1   ATGACGATGCGACCTGATGACCACCGAAGGAAATGGGACAAGAACGAGTACGAGAAGCTG 60


11586R-1.IR_full       61  GCGGCGCGAGCGGCTGCTCAACCAGGTGGCACCCAAGGAAGAAGAACCCGTACAGCGGGA 120
                           |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||
11586R-1.in silico     61  GCGGCG-GAGCGGCTGCTCAACCAGGTGGCACCCAAGGAAGAAGAACCCGTACAGCGGGA 120


11586R-1.IR_full       121 GAACCTCAAGCGACGCGACTATAAGGTGGACCTGGACAGCAAGCTGGGCAAGAGCGTTGT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11586R-1.in silico     121 GAACCTCAAGCGACGCGACTATAAGGTGGACCTGGACAGCAAGCTGGGCAAGAGCGTTGT 180


11586R-1.IR_full       181 CATCAACAAGAACACACCCACCTCGCAATCCGGTGGCTATTACTGCAACGTTTGCGACTG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11586R-1.in silico     181 CATCAACAAGAACACACCCACCTCGCAATCCGGTGGCTATTACTGCAACGTTTGCGACTG 240


11586R-1.IR_full       241 CGTGGTCAAGGATTCCATCAACTTTCTGGACCACATCAATGGCAAGAAGCACCAGCGCAA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11586R-1.in silico     241 CGTGGTCAAGGATTCCATCAACTTTCTGGACCACATCAATGGCAAGAAGCACCAGCGCAA 300


11586R-1.IR_full       301 TCTGGGCATGTCCATGAAGGTGGAGCGGAGCACCGTCGACCAGGTAAAGGAGCGCTTCCA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11586R-1.in silico     301 TCTGGGCATGTCCATGAAGGTGGAGCGGAGCACCGTCGACCAGGTAAAGGAGCGCTTCCA 360


11586R-1.IR_full       361 GCAGAACAAGAAGAAGATGGAGGAGAAGCAGAAAGACTACGAGCTCGAGCGCCGCCTGCG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11586R-1.in silico     361 GCAGAACAAGAAGAAGATGGAGGAGAAGCAGAAAGACTACGAGCTCGAGCGCCGCCTGCG 420


11586R-1.IR_full       421 GGAGGCCAAGGAGGAGGAGGATCATTGCTACAAGGAACACCGCAAGGAGAAGCGAAAAGA 480
                           |||||||||||||||||||||||   ||||||||||||||||||||||||||||||||||
11586R-1.in silico     421 GGAGGCCAAGGAGGAGGAGGATC---GCTACAAGGAACACCGCAAGGAGAAGCGAAAAGA 480


11586R-1.IR_full       481 GNGGAAGCGCAAGG 494
                           | ||||||||||||
11586R-1.in silico     481 GCGGAAGCGCAAGG 494

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   472  NM_139624.2  CG11586-RA (CG11586), mRNA 
0.21   NM_135724.2  CG5427-RA (Oatp33Ea), mRNA 
0   11  NM_132430.2  CG11207-RA (feo), mRNA 
0   NM_170430.2  CG31037-RA (ca), mRNA 
0   28  NM_176556.1  CG33106-RA, transcript variant A (mask), mRNA 
0   28  NM_176557.1  CG33106-RB, transcript variant B (mask), mRNA 
0   NM_057956.2  CG10269-RA (D19A), mRNA 
0   NM_057450.3  CG9704-RB, transcript variant B (Nrt), mRNA 
0   NM_168682.1  CG9704-RA, transcript variant A (Nrt), mRNA 
0   11  NM_143713.2  CG2173-RA (Rs1), mRNA 
0   10  NM_167649.1  CG32533-RA (CG32533), mRNA 
0   NM_165581.1  CG11198-RB, transcript variant B (CG11198), mRNA 
0   NM_136498.1  CG11198-RA, transcript variant A (CG11198), mRNA 
0   NM_136443.2  CG1620-RA (CG1620), mRNA 
0   NM_141738.3  CG6303-RA (Bruce), mRNA 
0   NM_058119.3  CG18783-RA, transcript variant A (Kr-h1), mRNA 
0   NM_058118.3  CG18783-RB, transcript variant B (Kr-h1), mRNA 
0   11  NM_142487.1  CG7709-RA (CG7709), mRNA 
0   NM_130478.2  CG2995-RA (CG2995), mRNA 
0   NM_132200.1  CG1531-RB (CG1531), mRNA 
0   NM_141533.2  CG7459-RA (Ctr1B), mRNA 
0   NM_133061.2  CG32549-RD, transcript variant D (CG32549), mRNA 
0   NM_206785.1  CG32549-RF, transcript variant F (CG32549), mRNA 
0   NM_206787.1  CG32549-RA, transcript variant A (CG32549), mRNA 
0   NM_167615.1  CG32549-RC, transcript variant C (CG32549), mRNA 
0   NM_167614.1  CG32549-RE, transcript variant E (CG32549), mRNA 
0   NM_206786.1  CG32549-RB, transcript variant B (CG32549), mRNA 
0   NM_169138.1  CG31367-RA (CG31367), mRNA 
0   NM_170037.1  CG31151-RA, transcript variant A (wge), mRNA 
0   NM_001043281.1  CG31151-RC, transcript variant C (wge), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.