National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11537Ra-4 
 Symbol CG11537  Full Name CG11537 
 CG No CG11537  Old CG No CG11537 
 Synonyms CG11537 
 Accession No (Link to NCBI) NM_167988.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTACAGATCGGGATGGGGATGC 
 Primer Seq. 3'
aatctagaggtaccCGCGAATCCACTCGAAGAAGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TACAGATCGG GATGGGGATG CCGATCGAGA GCGNNNGNAG TCGGGTGAAC AGACGGACAG 
0061 TCTGAGCACG CGCAGCAGCA GCTCCACGCC GACAACGGCG GACGTGGCCG ATGTGGAGAC 
0121 GATCAGCTCC CTGCCGCTCT CACCACCCGC CTTTGGCGGT CGGGGCAATC AGCTGGTCAA 
0181 GCGTCACTCT CCGCTGAAGG ACAAGCAGGC AGAGCAGGCG GACAGCAGCT CCAGCTCCAG 
0241 CTGCAGTCAG CAGCCCGATG CGGACGATGT GCCCACGACT TCGCGGTATG CAGNTGCAGC 
0301 ANCACATCCT AGTGTTCNTN GCATTCGCGG AGACGGCGAT CACCGCGTCG TCGGGATCGG 
0361 GCCGAGTGTG CGGCGGTAGC GGAGGAGCCG CCCACAGGCG CACCCACTCG GCCGCCTCCT 
0421 ACATCTCGAT GAGATCGCAG GGCGGCAACT CGGAGGCGAC TCCGGAGCGA CCAAAGCGAA 
0481 CCGCTTCTTC GAGTGGATTC GCG 
 in silico PCR Fragment
0001 TACAGATCGG GATGGGGATG CCGATCGAGA GCGGCAGGAG TCGGGTGAAC AGACGGACAG 
0061 TCTGAGCACG CGTAGCAGCA GCTCCACGCC GACAACGGCG GACGTGGCCG ATGTGGAGAC 
0121 GATCAGCTCC CTGCCGCTCT CACCACCCGC CTTTGGCGGT CGGGGCAATC AGCTGGTCAA 
0181 GCGTCACTCT CCGCTGAAGG ACAAGCAGGC AGAGCAGGCG GACAGCAGCT CCAGCTCCAG 
0241 CTGCAGTCAG CAGCCCGATG CGGACGATGT GCCCACGACT TCGCGGTATG CAGCTGCAGC 
0301 AGCACATCCC AGCGCGGCAT TCGCGGAGAC GGCGATCACC GCGTCGTCGG GATCGGGCCG 
0361 AGTGTGCGGC GGTAGCGGAG GAGCCGCCCA CAGGCGCACC CACTCGGCCG CCTCCTACAT 
0421 CTCGATGAGA TCGCAGGGCG GCAACTCGGA GGCGACTCCG GAGCGACCAA AGCGTAACCG 
0481 CTTCTTCGAG TGGATTCGCG  
 Assemble Data

11537Ra-4.IR full       1   TACAGATCGGGATGGGGATGCCGATCGAGAGCGNNNGNAGTCGGGTGAACAGACGGACAG 60
                            |||||||||||||||||||||||||||||||||   | ||||||||||||||||||||||
11537Ra-4.in silico     1   TACAGATCGGGATGGGGATGCCGATCGAGAGCGGCAGGAGTCGGGTGAACAGACGGACAG 60


11537Ra-4.IR full       61  TCTGAGCACGCGCAGCAGCAGCTCCACGCCGACAACGGCGGACGTGGCCGATGTGGAGAC 120
                            |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
11537Ra-4.in silico     61  TCTGAGCACGCGTAGCAGCAGCTCCACGCCGACAACGGCGGACGTGGCCGATGTGGAGAC 120


11537Ra-4.IR full       121 GATCAGCTCCCTGCCGCTCTCACCACCCGCCTTTGGCGGTCGGGGCAATCAGCTGGTCAA 180
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11537Ra-4.in silico     121 GATCAGCTCCCTGCCGCTCTCACCACCCGCCTTTGGCGGTCGGGGCAATCAGCTGGTCAA 180


11537Ra-4.IR full       181 GCGTCACTCTCCGCTGAAGGACAAGCAGGCAGAGCAGGCGGACAGCAGCTCCAGCTCCAG 240
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11537Ra-4.in silico     181 GCGTCACTCTCCGCTGAAGGACAAGCAGGCAGAGCAGGCGGACAGCAGCTCCAGCTCCAG 240


11537Ra-4.IR full       241 CTGCAGTCAGCAGCCCGATGCGGACGATGTGCCCACGACTTCGCGGTATGCAGNTGCAGC 300
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
11537Ra-4.in silico     241 CTGCAGTCAGCAGCCCGATGCGGACGATGTGCCCACGACTTCGCGGTATGCAGCTGCAGC 300


11537Ra-4.IR full       301 ANCACATCCTAGTGTTCNTNGCATTCGCGGAGACGGCGATCACCGCGTCGTCGGGATCGG 360
                            | ||||||| ||    |   ||||||||||||||||||||||||||||||||||||||||
11537Ra-4.in silico     301 AGCACATCCCAG----CGCGGCATTCGCGGAGACGGCGATCACCGCGTCGTCGGGATCGG 360


11537Ra-4.IR full       361 GCCGAGTGTGCGGCGGTAGCGGAGGAGCCGCCCACAGGCGCACCCACTCGGCCGCCTCCT 420
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11537Ra-4.in silico     361 GCCGAGTGTGCGGCGGTAGCGGAGGAGCCGCCCACAGGCGCACCCACTCGGCCGCCTCCT 420


11537Ra-4.IR full       421 ACATCTCGATGAGATCGCAGGGCGGCAACTCGGAGGCGACTCCGGAGCGACCAAAGCG-A 480
                            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
11537Ra-4.in silico     421 ACATCTCGATGAGATCGCAGGGCGGCAACTCGGAGGCGACTCCGGAGCGACCAAAGCGTA 480


11537Ra-4.IR full       481 ACCGCTTCTTCGAGTGGATTCGCG 504
                            ||||||||||||||||||||||||
11537Ra-4.in silico     481 ACCGCTTCTTCGAGTGGATTCGCG 504

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.