National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11451R-1 
 Symbol CG11451  Full Name CG11451 
 CG No CG11451  Old CG No CG11451 
 Synonyms CG11451 
 Accession No (Link to NCBI) NM_141002.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCGTAAGGTGCCGACCAAGGA 
 Primer Seq. 3'
aatctagaggtaccCGATTTGGTGGCGGTTGACGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GCGTAAGGTG CCGACCAAGG AAGATGAGGC GACCACAACA ACGTCCGCGA TCAAACAACA 
0061 AATCAAGCGA CGCATCAGTT TCAGTGGCAA GAAGTCCGTG AGGGAATTCG TAAACACCAA 
0121 GGAGACCAAC AACTGGGACG ACTCGTACGA GGTGTCGGAA CACCATGCTG AGGACAGCTC 
0181 GGGATCGAAG TGCTGCAGCA CAGGATCAGC ATCAGTAGCG AGGGTTTCCG AACATGCCGA 
0241 CAAGGAGAAC ATTCCCCTGC CCAGCCACTG CGAGCGGGAA CATGTCGATC TGTCCGTGAA 
0301 TCTGCAGGCC AGCGTGGATT TCACCCTGCT GCCCTGCGAA ATGATGGACA AATCGAGGAA 
0361 GACATCCTCA ATCTCTGCTG TGTCCTTTTG CATGACCTCC GAGGAGCGAA AACTGTTGCA 
0421 AAGCAGTCTC AGCGACCGCC AGCTGGTAGA CAAGACCATG GATCTGATAT CCGGATCTCT 
0481 CGTCAACCGC CACCAAATCG  
 in silico PCR Fragment
0001 GCGTAAGGTG CCGACCAAGG AAGATGAGGC GACCACAACA ACGTCCGCGA TCAAACAACA 
0061 AATCAAGCGA CGCATCAGTT TCAGTGGCAA GAAGTCCGTG AGGGAATTCG TAAACACCAA 
0121 GGAGACCAAC AACTGGGACG ACTCGTACGA GGTGTCGGAA CACCATGCTG AGGACAGCTC 
0181 GGGATCGAAG TGCTGCAGCA CAGGATCAGC ATCAGTAGCG AGGGTTTCCG AACATGCCGA 
0241 CAAGGAGAAC ATTCCCCTGC CCAGCCACTG CGAGCGGGAA CATGTCGATC TGTCCGTGAA 
0301 TCTGCAGGCC AGCGTGGATT TCACCCTGCT GCCCTGCGAA ATGATGGACA AATCGAGGAA 
0361 GACATCCTCA ATCTCTGCTG TGTCCTTTTG CATGACCTCC GAGGAGCGAA AACTGTTGCA 
0421 AAGCAGTCTC AGCGACCGCC AGCTGGTAGA CAAGACCATG GATCTGATAT CCGGATCTCT 
0481 CGTCAACCGC CACCAAATCG  
 Assemble Data

11451R-1.IR_full       1   GCGTAAGGTGCCGACCAAGGAAGATGAGGCGACCACAACAACGTCCGCGATCAAACAACA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11451R-1.in silico     1   GCGTAAGGTGCCGACCAAGGAAGATGAGGCGACCACAACAACGTCCGCGATCAAACAACA 60


11451R-1.IR_full       61  AATCAAGCGACGCATCAGTTTCAGTGGCAAGAAGTCCGTGAGGGAATTCGTAAACACCAA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11451R-1.in silico     61  AATCAAGCGACGCATCAGTTTCAGTGGCAAGAAGTCCGTGAGGGAATTCGTAAACACCAA 120


11451R-1.IR_full       121 GGAGACCAACAACTGGGACGACTCGTACGAGGTGTCGGAACACCATGCTGAGGACAGCTC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11451R-1.in silico     121 GGAGACCAACAACTGGGACGACTCGTACGAGGTGTCGGAACACCATGCTGAGGACAGCTC 180


11451R-1.IR_full       181 GGGATCGAAGTGCTGCAGCACAGGATCAGCATCAGTAGCGAGGGTTTCCGAACATGCCGA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11451R-1.in silico     181 GGGATCGAAGTGCTGCAGCACAGGATCAGCATCAGTAGCGAGGGTTTCCGAACATGCCGA 240


11451R-1.IR_full       241 CAAGGAGAACATTCCCCTGCCCAGCCACTGCGAGCGGGAACATGTCGATCTGTCCGTGAA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11451R-1.in silico     241 CAAGGAGAACATTCCCCTGCCCAGCCACTGCGAGCGGGAACATGTCGATCTGTCCGTGAA 300


11451R-1.IR_full       301 TCTGCAGGCCAGCGTGGATTTCACCCTGCTGCCCTGCGAAATGATGGACAAATCGAGGAA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11451R-1.in silico     301 TCTGCAGGCCAGCGTGGATTTCACCCTGCTGCCCTGCGAAATGATGGACAAATCGAGGAA 360


11451R-1.IR_full       361 GACATCCTCAATCTCTGCTGTGTCCTTTTGCATGACCTCCGAGGAGCGAAAACTGTTGCA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11451R-1.in silico     361 GACATCCTCAATCTCTGCTGTGTCCTTTTGCATGACCTCCGAGGAGCGAAAACTGTTGCA 420


11451R-1.IR_full       421 AAGCAGTCTCAGCGACCGCCAGCTGGTAGACAAGACCATGGATCTGATATCCGGATCTCT 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11451R-1.in silico     421 AAGCAGTCTCAGCGACCGCCAGCTGGTAGACAAGACCATGGATCTGATATCCGGATCTCT 480


11451R-1.IR_full       481 CGTCAACCGCCACCAAATCG 500
                           ||||||||||||||||||||
11451R-1.in silico     481 CGTCAACCGCCACCAAATCG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_141002.1  CG11451-RA (CG11451), mRNA 
0   NM_132061.1  CG5937-RA (CG5937), mRNA 
0   NM_168487.1  CG32096-RB, transcript variant B (rols), mRNA 
0   NM_140285.2  CG32096-RD, transcript variant D (rols), mRNA 
0   NM_168490.1  CG32096-RE, transcript variant E (rols), mRNA 
0   NM_168488.1  CG32096-RA, transcript variant A (rols), mRNA 
0   NM_168489.1  CG32096-RC, transcript variant C (rols), mRNA 
0   NM_140898.3  CG32217-RA (Su(Tpl)), mRNA 
0   NM_132660.2  CG1716-RA (CG1716), mRNA 
0   NM_079163.2  CG1960-RA, transcript variant A (mu2), mRNA 
0   NM_167927.1  CG1960-RB, transcript variant B (mu2), mRNA 
0   NM_136904.1  CG13171-RA (CG13171), mRNA 
0   10  NM_079488.3  CG9054-RA (Ddx1), mRNA 
0   NM_139962.3  CG7163-RB, transcript variant B (mkg-p), mRNA 
0   NM_176299.1  CG33057-RA, transcript variant A (CG33057), mRNA 
0   NM_168272.1  CG7163-RA, transcript variant A (mkg-p), mRNA 
0   17  NM_166019.1  CG18076-RH, transcript variant H (shot), mRNA 
0   16  NM_166015.1  CG18076-RG, transcript variant G (shot), mRNA 
0   16  NM_166016.1  CG18076-RB, transcript variant B (shot), mRNA 
0   16  NM_079009.2  CG18076-RA, transcript variant A (shot), mRNA 
0   13  NM_166018.1  CG18076-RC, transcript variant C (shot), mRNA 
0   13  NM_166017.1  CG18076-RE, transcript variant E (shot), mRNA 
0   NM_143009.1  CG6607-RA (CG6607), mRNA 
0   NM_137393.2  CG4924-RA (icln), mRNA 
0   NM_141277.2  CG1172-RA (CG1172), mRNA 
0   NM_205921.1  CG13788-RB, transcript variant B (Gr28b), mRNA 
0   NM_141831.1  CG5342-RA (CG5342), mRNA 
0   NM_130725.2  CG15239-RA (CG15239), mRNA 
0   NM_058071.3  CG7885-RA, transcript variant A (RpII33), mRNA 
0   NM_136539.1  CG11669-RA (CG11669), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.