National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11418R-1 
 Symbol CG11418  Full Name CG11418 
 CG No CG11418  Old CG No CG11418 
 Synonyms EG:8D8.8, DmNP_569904, CG11418 
 Accession No (Link to NCBI) NM_130548.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Bratic A, Clemente P, Calvo-Garrido J, Maffezzini C, Felser A, Wibom R, Wedell A, Freyer C, Wredenberg A.
Mitochondrial Polyadenylation Is a One-Step Process Required for mRNA Integrity and tRNA Maturation.
PLoS Genet. (2016) 12(5) e1006028 [ PubMed ID = 27176048 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| silico     1   CACAATGCTTCAGAGGCGGCTTCTCCCGGACGGAACGCAGGCAGGCCCAACTACGAGGAG 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  TTCATTGGCCGTCATCAGCGACAGGCCCAGTGCAGCATTGTGGTCCAGGTGAGCTCCGAA 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 AAGTCGTATGAGGAGTTGTATAACTACTGCAGCAGCTTCGGCTCGATCATGGGTGCCCAC 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CACTACTGCGTGCGGCAGGACGAGACCCTGCACTACATCCTGCTGGAGTACGCCACGTCG 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GACGAGGCGGCGGCTGCCATCGGAGCGGGCGTTACCAATGGCGAGCTGAGCGGCGTGCCC 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GTGCGATCTCCCTTTCTGTGGTTCCGGGCAGCGGGAGGAGGCAGACGGAGCCCCAAGCTA 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GTTGCCAATACAGCGCCCGCACTGCTATCCTTGGACGGCACCCGGCAGGTGGATCAGCGC 420

                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| silico     421 CACCTACTGGGGCTCTTACGTGGTGCAGCGGACATCGAAGAGCAGGTGCAGCAGC-TGTA 480

11418R-1.IR_full       481 CGAGCACACGCGCCTGAATGA 501
                           ||||||||||||||||||||| silico     481 CGAGCACACGCGCCTGAATGA 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_130548.2  CG11418-RA, transcript variant A (CG11418), mRNA 
0   NM_166992.2  CG2904-RA (ec), mRNA 
0   NM_135121.2  CG8965-RA (CG8965), mRNA 
0   NM_135348.2  CG8451-RA (CG8451), mRNA 
0   12  NM_168007.1  CG11505-RA, transcript variant A (CG11505), mRNA 
0   12  NM_139536.1  CG11505-RB, transcript variant B (CG11505), mRNA 
0   NM_131934.1  CG3626-RA (CG3626), mRNA 
0   NM_135573.2  CG7384-RA (CG7384), mRNA 
0   NM_080214.2  CG10913-RA (Spn6), mRNA 
0   NM_164637.1  CG14025-RB, transcript variant B (Bsg25D), mRNA 
0   NM_057568.4  CG14025-RA, transcript variant A (Bsg25D), mRNA 
0   NM_164638.1  CG14025-RC, transcript variant C (Bsg25D), mRNA 
0   NM_133143.1  CG8002-RA (rictor), mRNA 
0   NM_164692.2  CG31638-RA (CG31638), mRNA 
0   NM_132346.1  CG3003-RB (CG3003), mRNA 
0   NM_130725.2  CG15239-RA (CG15239), mRNA 
0   NM_169089.2  CG1250-RB, transcript variant B (sec23), mRNA 
0   NM_169088.1  CG1250-RA, transcript variant A (sec23), mRNA 
0   NM_136057.1  CG10373-RA (CG10373), mRNA 
0   22  NM_080110.2  CG32356-RA, transcript variant A (ImpE1), mRNA 
0   NM_169122.1  CG10279-RB, transcript variant B (Rm62), mRNA 
0   NM_169121.1  CG10279-RF, transcript variant F (Rm62), mRNA 
0   NM_079519.2  CG10279-RA, transcript variant A (Rm62), mRNA 
0   NM_169120.1  CG10279-RC, transcript variant C (Rm62), mRNA 
0   NM_169118.1  CG10279-RD, transcript variant D (Rm62), mRNA 
0   NM_169119.1  CG10279-RE, transcript variant E (Rm62), mRNA 
0   NM_001014557.1  CG33545-RA (nab), mRNA 
0   NM_139823.1  CG14825-RA (BBS1), mRNA 
0   NM_136594.1  CG8172-RA (CG8172), mRNA 
0   NM_140795.2  CG4120-RA (Cyp12c1), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.