National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11415R-1 
 Symbol Tsp2A  Full Name Tetraspanin 2A 
 CG No CG11415  Old CG No CG11415 
 Synonyms EG:8D8.7, CG11415, D8.7, Dm.Tsp2A, Tsp2A 
 Accession No (Link to NCBI) NM_080298.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATCGGCTATGGAGCCTCCGAC 
 Primer Seq. 3'
aatctagaggtaccAGATAATCCCATGGCCCGGTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATCGGCTATG GAGCCTCCGA CGAGCAGCTG GAGAAGCAAA TTGGCTGCGT GAAATACACG 
0061 CTATTTTGCT TCAACATCGT GGCCTGGATG ATATCCACAG CGCTGTTCGC CCTAACCGTC 
0121 TGGTTGAGGG CTGAGCCCGG CTTCAACGAC TGGCTGCGCA TCCTGGAGGC ACAGTCCTTC 
0181 TACATCGGCG TGTACGTGCT CATCGGCATC AGCATTGTAA TGATGGCCGT CAGCTTCCTC 
0241 GGCTGCCTGA GCGCGCTCAT GGAGAACACC CTGGCTCTGT TTGTGTTCGT GGGCACCCAG 
0301 GTCTTTGGGT TCATCGCCAT TGTGGCCGGG TCGGCGGTCC TATTGCAGTT CAGCACTATC 
0361 AACTCGAGCC TGCAGCCGCT GCTGAATGTA TCGCTGCGCG GCTTTGTGGC CACATCGGAG 
0421 TATACGTACT CGAACTACGT GCTGACCATG ATTCAGGAGA ACATAGGTTG TTGCGGGGCC 
0481 ACCGGGCCAT GGGNATTATC T 
 in silico PCR Fragment
0001 ATCGGCTATG GAGCCTCCGA CGAGCAGCTG GAGAAGCAAA TTGGCTGCGT GAAATACACG 
0061 CTATTTTGCT TCAACATCGT GGCCTGGATG ATATCCACAG CGCTGTTCGC CCTAACCGTC 
0121 TGGTTGAGGG CTGAGCCCGG CTTCAACGAC TGGCTGCGCA TCCTGGAGGC ACAGTCCTTC 
0181 TACATCGGCG TGTACGTGCT CATCGGCATC AGCATTGTAA TGATGGCCGT CAGCTTCCTC 
0241 GGCTGCCTGA GCGCGCTCAT GGAGAACACC CTGGCTCTGT TTGTGTTCGT GGGCACCCAG 
0301 GTCTTTGGGT TCATCGCCAT TGTGGCCGGG TCGGCGGTCC TATTGCAGTT CAGCACTATC 
0361 AACTCGAGCC TGCAGCCGCT GCTGAATGTA TCGCTGCGCG GCTTTGTGGC CACATCGGAG 
0421 TATACGTACT CGAACTACGT GCTGACCATG ATTCAGGAGA ACATAGGTTG TTGCGGGGCC 
0481 ACCGGGCCAT GGG-ATTATC T 
 Assemble Data

11415R-1.IR_full       1   ATCGGCTATGGAGCCTCCGACGAGCAGCTGGAGAAGCAAATTGGCTGCGTGAAATACACG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11415R-1.in silico     1   ATCGGCTATGGAGCCTCCGACGAGCAGCTGGAGAAGCAAATTGGCTGCGTGAAATACACG 60


11415R-1.IR_full       61  CTATTTTGCTTCAACATCGTGGCCTGGATGATATCCACAGCGCTGTTCGCCCTAACCGTC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11415R-1.in silico     61  CTATTTTGCTTCAACATCGTGGCCTGGATGATATCCACAGCGCTGTTCGCCCTAACCGTC 120


11415R-1.IR_full       121 TGGTTGAGGGCTGAGCCCGGCTTCAACGACTGGCTGCGCATCCTGGAGGCACAGTCCTTC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11415R-1.in silico     121 TGGTTGAGGGCTGAGCCCGGCTTCAACGACTGGCTGCGCATCCTGGAGGCACAGTCCTTC 180


11415R-1.IR_full       181 TACATCGGCGTGTACGTGCTCATCGGCATCAGCATTGTAATGATGGCCGTCAGCTTCCTC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11415R-1.in silico     181 TACATCGGCGTGTACGTGCTCATCGGCATCAGCATTGTAATGATGGCCGTCAGCTTCCTC 240


11415R-1.IR_full       241 GGCTGCCTGAGCGCGCTCATGGAGAACACCCTGGCTCTGTTTGTGTTCGTGGGCACCCAG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11415R-1.in silico     241 GGCTGCCTGAGCGCGCTCATGGAGAACACCCTGGCTCTGTTTGTGTTCGTGGGCACCCAG 300


11415R-1.IR_full       301 GTCTTTGGGTTCATCGCCATTGTGGCCGGGTCGGCGGTCCTATTGCAGTTCAGCACTATC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11415R-1.in silico     301 GTCTTTGGGTTCATCGCCATTGTGGCCGGGTCGGCGGTCCTATTGCAGTTCAGCACTATC 360


11415R-1.IR_full       361 AACTCGAGCCTGCAGCCGCTGCTGAATGTATCGCTGCGCGGCTTTGTGGCCACATCGGAG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11415R-1.in silico     361 AACTCGAGCCTGCAGCCGCTGCTGAATGTATCGCTGCGCGGCTTTGTGGCCACATCGGAG 420


11415R-1.IR_full       421 TATACGTACTCGAACTACGTGCTGACCATGATTCAGGAGAACATAGGTTGTTGCGGGGCC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11415R-1.in silico     421 TATACGTACTCGAACTACGTGCTGACCATGATTCAGGAGAACATAGGTTGTTGCGGGGCC 480


11415R-1.IR_full       481 ACCGGGCCATGGGNATTATCT 501
                           ||||||||||||| |||||||
11415R-1.in silico     481 ACCGGGCCATGGG-ATTATCT 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.