National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11412R-1 
 Symbol CG11412  Full Name CG11412 
 CG No CG11412  Old CG No CG11412 
 Synonyms EG:8D8.6, DmAAF45606, CG11412 
 Accession No (Link to NCBI) NM_166878.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCGGCCGGAAAGAAGAAGTACA 
 Primer Seq. 3'
aatctagaggtaccCACTTTTGGTTTTGGGTCCGT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CGGCCGGAAA GAAGAAGTAC AAGAACAAAA AGAACTCAGC GGAGAAGAAC CCCAATCACA 
0061 ATCCAAATTC CAGTGGCCAG GTGGAGGCAC AGACACCCAG CAATGGACAC GTTCAGCACC 
0121 AAAGAGGAGG AGGCGACGGA AGACACAGGA GCCAAGCGCA GGAACTCAGA GGCCTGCTTA 
0181 AAAAGATGCA CCTTTGCAAT GGCCATGGTC ACAAGGAGCA GGAGGCTCGG CCGCTTGGGG 
0241 AGGTCGTCAA TGGCCATGCA CATGGGCACA GCAACAACAA TCACATTCGC TGCACAAGCG 
0301 GCAGCAGCAA CAACAACAAC AGCACTCACA ACAACAACAG CGTGGACAGC AGCAACAACA 
0361 ACCGCAAGCA GCGCTCCCCA AGAGAAGGAG GCGACGGCGG AGGATCGGAT TCGAACTCCC 
0421 TCAAACCGGA GGAGAAGCCC ATAACAGCCA CAAGCAAAAC CACTGCCAAC ATACACCCAA 
0481 CCACAACGAC GGACCCAAAA CCAAAAGTG 
 in silico PCR Fragment
0001 CGGCCGGAAA GAAGAAGTAC AAGAACAAAA AGAACTCAGC GGAGAAGAAC CCCAATCACA 
0061 ATCCAAATTC CAGTGGCCAG GTGGAGGCAC AGACACCCAG CAATGGACAC GTTCAGCACC 
0121 -AAGAGGAGG AGGCGACGGA AGAC-CAGGA GCC-AGCGCA GGAACTCAGA GGCCTGCTTA 
0181 AAAAGATGCA CCTTTGCAAT GGCCATGGTC ACAAGGAGCA GGAGGCTCGG CCGCTTGGGG 
0241 AGGTCGTCAA TGGCCATGCA CATGGGCACA GCAACAACAA TCACATTCGC TGCACAAGCG 
0301 GCAGCAGCAA CAACAACAAC AGCACTCACA ACAACAACAG CGTGGACAGC AGCAACAACA 
0361 ACCGCAAGCA GCG------A AGAGAAGGAG GCGACGGCGG AGGATCGGAT TCGAACTCCC 
0421 TCAAACCGGA GGAGAAGCCC ATAACAGCCA CAAGCAAAAC CACTGCCAAC ATACACCCAA 
0481 CCACAACGAC GGACCCAAAA CCAAAAGTG 
 Assemble Data

11412R-1.IR_full       1   CGGCCGGAAAGAAGAAGTACAAGAACAAAAAGAACTCAGCGGAGAAGAACCCCAATCACA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11412R-1.in silico     1   CGGCCGGAAAGAAGAAGTACAAGAACAAAAAGAACTCAGCGGAGAAGAACCCCAATCACA 60


11412R-1.IR_full       61  ATCCAAATTCCAGTGGCCAGGTGGAGGCACAGACACCCAGCAATGGACACGTTCAGCACC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11412R-1.in silico     61  ATCCAAATTCCAGTGGCCAGGTGGAGGCACAGACACCCAGCAATGGACACGTTCAGCACC 120


11412R-1.IR_full       121 AAAGAGGAGGAGGCGACGGAAGACACAGGAGCCAAGCGCAGGAACTCAGAGGCCTGCTTA 180
                            ||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||
11412R-1.in silico     121 -AAGAGGAGGAGGCGACGGAAGAC-CAGGAGCC-AGCGCAGGAACTCAGAGGCCTGCTTA 180


11412R-1.IR_full       181 AAAAGATGCACCTTTGCAATGGCCATGGTCACAAGGAGCAGGAGGCTCGGCCGCTTGGGG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11412R-1.in silico     181 AAAAGATGCACCTTTGCAATGGCCATGGTCACAAGGAGCAGGAGGCTCGGCCGCTTGGGG 240


11412R-1.IR_full       241 AGGTCGTCAATGGCCATGCACATGGGCACAGCAACAACAATCACATTCGCTGCACAAGCG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11412R-1.in silico     241 AGGTCGTCAATGGCCATGCACATGGGCACAGCAACAACAATCACATTCGCTGCACAAGCG 300


11412R-1.IR_full       301 GCAGCAGCAACAACAACAACAGCACTCACAACAACAACAGCGTGGACAGCAGCAACAACA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11412R-1.in silico     301 GCAGCAGCAACAACAACAACAGCACTCACAACAACAACAGCGTGGACAGCAGCAACAACA 360


11412R-1.IR_full       361 ACCGCAAGCAGCGCTCCCCAAGAGAAGGAGGCGACGGCGGAGGATCGGATTCGAACTCCC 420
                           |||||||||||||      |||||||||||||||||||||||||||||||||||||||||
11412R-1.in silico     361 ACCGCAAGCAGCG------AAGAGAAGGAGGCGACGGCGGAGGATCGGATTCGAACTCCC 420


11412R-1.IR_full       421 TCAAACCGGAGGAGAAGCCCATAACAGCCACAAGCAAAACCACTGCCAACATACACCCAA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11412R-1.in silico     421 TCAAACCGGAGGAGAAGCCCATAACAGCCACAAGCAAAACCACTGCCAACATACACCCAA 480


11412R-1.IR_full       481 CCACAACGACGGACCCAAAACCAAAAGTG 509
                           |||||||||||||||||||||||||||||
11412R-1.in silico     481 CCACAACGACGGACCCAAAACCAAAAGTG 509

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  30  34  NM_130547.3  CG11412-RC, transcript variant C (CG11412), mRNA 
100   482  30  34  NM_166878.1  CG11412-RA, transcript variant A (CG11412), mRNA 
84.85   409  31  37  NM_166879.1  CG11412-RB, transcript variant B (CG11412), mRNA 
2.69   13  86  277  609  NM_168571.2  CG32133-RA (CG32133), mRNA 
2.69   13  24  134  230  NM_176556.1  CG33106-RA, transcript variant A (mask), mRNA 
2.69   13  24  134  229  NM_176557.1  CG33106-RB, transcript variant B (mask), mRNA 
2.28   11  33  100  235  NM_206357.2  CG33261-RD, transcript variant D (Trl), mRNA 
2.28   11  33  95  193  NM_206358.2  CG33261-RA, transcript variant A (Trl), mRNA 
2.28   11  33  95  192  NM_206360.1  CG33261-RF, transcript variant F (Trl), mRNA 
2.07   10  39  124  339  NM_078592.2  CG11172-RA (NFAT), mRNA 
2.07   10  22  89  167  NM_132246.2  CG10555-RA (CG10555), mRNA 
1.65   18  54  189  NM_168237.1  CG17888-RD, transcript variant D (Pdp1), mRNA 
1.65   22  20  NM_176009.1  CG33129-RE, transcript variant E (CG33129), mRNA 
1.45   45  186  NM_166057.1  CG8787-RA, transcript variant A (Asx), mRNA 
1.45   45  182  NM_001014527.1  CG8787-RB, transcript variant B (Asx), mRNA 
1.45   26  39  NM_057669.2  CG12399-RA (Mad), mRNA 
1.24   33  121  227  NM_137690.2  CG10543-RA, transcript variant A (CG10543), mRNA 
1.24   33  120  214  NM_176241.1  CG10543-RC, transcript variant C (CG10543), mRNA 
1.24   33  120  214  NM_166416.1  CG10543-RB, transcript variant B (CG10543), mRNA 
1.24   31  48  182  NM_206356.2  CG33261-RB, transcript variant B (Trl), mRNA 
1.24   31  43  140  NM_001038926.1  CG33261-RI, transcript variant I (Trl), mRNA 
1.24   26  63  255  NM_167000.1  CG32778-RA (CG32778), mRNA 
1.24   24  60  136  NM_001043134.1  CG7368-RB (CG7368), mRNA 
1.24   17  63  136  NM_167581.2  CG7826-RA, transcript variant A (mnb), mRNA 
1.24   17  53  145  NM_169292.2  CG9381-RC, transcript variant C (mura), mRNA 
1.24   17  53  134  NM_141645.2  CG9381-RA, transcript variant A (mura), mRNA 
1.24   17  53  134  NM_169291.1  CG9381-RB, transcript variant B (mura), mRNA 
1.24   16  60  168  NM_140939.2  CG17233-RB, transcript variant B (CG17233), mRNA 
1.24   16  60  168  NM_168837.1  CG17233-RC, transcript variant C (CG17233), mRNA 
1.24   15  52  142  NM_168836.1  CG17233-RA, transcript variant A (CG17233), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.