National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1136R-1 
 Symbol CG1136  Full Name CG1136 
 CG No CG1136  Old CG No CG1136 
 Synonyms novel, CG1136 
 Accession No (Link to NCBI) NM_139596.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGTTGTTACTGGCAGCCAGACT 
 Primer Seq. 3'
aatctagaggtaccTCAATCTTGGCCGCTTGTTCG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GTTGTTACTG GCAGCCAGAC TCCCAGTGCG AATCAATACC ATATCCAGAC GGACGAGGGA 
0061 CCGGAGCGAT ACTTCCGCTT CCAAACGGAC AGCGGACAGT TCCGCAAGGA NAAACGGCTG 
0121 CAGGATGGCA CAGTCATCGG AACTGAGGCC TGGATCGATG CGGCGGGCTA TCTACGACAG 
0181 AAGGACTACA TTGCCGATAA GCAGGGATAC AGGATACTGA AGTCCAAGAC CATCTACGTG 
0241 GGCCTAGGAA GGGCCGTTGA GGACGCCATT AAATCCACCA AGGCAGCGCC AGCTCAATCG 
0301 GGTGTCCTAG TGCATGGCGG CTCCTCGGGA TCTTCGGCCA ACAGTCTGGG CAGCTATCAT 
0361 CGTCCCAGCT ATGGCTACAT TTCGAGCACC ACGTCCACCA CCACACCGGC TCCATATCCG 
0421 CCTCCAGCTC TACTGGACGT CGAGGACTCA GGTGCAGGCA AGCTCAATTA CTTGCCCCCC 
0481 GAACAAGCGG CCAAGATTGA  
 in silico PCR Fragment
0001 GTTGTTACTG GCAGCCAGAC TCCCAGTGCG AATCAATACC ATATCCAGAC GGACGAGGGA 
0061 CCGGAGCGAT ACTTCCGCTT CCAAACGGAC AGCGGACAGT TCCGCAAGGA GAAACGGCTG 
0121 CAGGATGGCA CAGTCATCGG AACTGAGGCC TGGATCGATG CGGCGGGCTA TCTACGACAG 
0181 AAGGACTACA TTGCCGATAA GCAGGGATAC AGGATACTGA AGTCCAAGAC CATCTACGTG 
0241 GGCCTAGGAA GGGCCGTTGA GGACGCCATT AAATCCACCA AGGCAGCGCC AGCTCAATCG 
0301 GGTGTCCTAG TGCATGGCGG CTCCTCGGGA TCTTCGGCCA ACAGTCTGGG CAGCTATCAT 
0361 CGTCCCAGCT ATGGCTACAT TTCGAGCACC ACGTCCACCA CCACACCGGC TCCATATCCG 
0421 CCTCCAGCTC TACTGGACGT CGAGGACTCA GGTGCAGGCA AGCTCAATTA CTTGCCCCCC 
0481 GAACAAGCGG CCAAGATTGA  
 Assemble Data

1136R-1.IR_full       1   GTTGTTACTGGCAGCCAGACTCCCAGTGCGAATCAATACCATATCCAGACGGACGAGGGA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1136R-1.in silico     1   GTTGTTACTGGCAGCCAGACTCCCAGTGCGAATCAATACCATATCCAGACGGACGAGGGA 60


1136R-1.IR_full       61  CCGGAGCGATACTTCCGCTTCCAAACGGACAGCGGACAGTTCCGCAAGGANAAACGGCTG 120
                          |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
1136R-1.in silico     61  CCGGAGCGATACTTCCGCTTCCAAACGGACAGCGGACAGTTCCGCAAGGAGAAACGGCTG 120


1136R-1.IR_full       121 CAGGATGGCACAGTCATCGGAACTGAGGCCTGGATCGATGCGGCGGGCTATCTACGACAG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1136R-1.in silico     121 CAGGATGGCACAGTCATCGGAACTGAGGCCTGGATCGATGCGGCGGGCTATCTACGACAG 180


1136R-1.IR_full       181 AAGGACTACATTGCCGATAAGCAGGGATACAGGATACTGAAGTCCAAGACCATCTACGTG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1136R-1.in silico     181 AAGGACTACATTGCCGATAAGCAGGGATACAGGATACTGAAGTCCAAGACCATCTACGTG 240


1136R-1.IR_full       241 GGCCTAGGAAGGGCCGTTGAGGACGCCATTAAATCCACCAAGGCAGCGCCAGCTCAATCG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1136R-1.in silico     241 GGCCTAGGAAGGGCCGTTGAGGACGCCATTAAATCCACCAAGGCAGCGCCAGCTCAATCG 300


1136R-1.IR_full       301 GGTGTCCTAGTGCATGGCGGCTCCTCGGGATCTTCGGCCAACAGTCTGGGCAGCTATCAT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1136R-1.in silico     301 GGTGTCCTAGTGCATGGCGGCTCCTCGGGATCTTCGGCCAACAGTCTGGGCAGCTATCAT 360


1136R-1.IR_full       361 CGTCCCAGCTATGGCTACATTTCGAGCACCACGTCCACCACCACACCGGCTCCATATCCG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1136R-1.in silico     361 CGTCCCAGCTATGGCTACATTTCGAGCACCACGTCCACCACCACACCGGCTCCATATCCG 420


1136R-1.IR_full       421 CCTCCAGCTCTACTGGACGTCGAGGACTCAGGTGCAGGCAAGCTCAATTACTTGCCCCCC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1136R-1.in silico     421 CCTCCAGCTCTACTGGACGTCGAGGACTCAGGTGCAGGCAAGCTCAATTACTTGCCCCCC 480


1136R-1.IR_full       481 GAACAAGCGGCCAAGATTGA 500
                          ||||||||||||||||||||
1136R-1.in silico     481 GAACAAGCGGCCAAGATTGA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_139596.2  CG1136-RA (CG1136), mRNA 
1.03   NM_206422.1  CG32447-RB, transcript variant B (CG32447), mRNA 
1.03   NM_168935.1  CG32447-RA, transcript variant A (CG32447), mRNA 
0.41   NM_142124.2  CG3508-RA, transcript variant A (CG3508), mRNA 
0.41   NM_169595.1  CG3508-RB, transcript variant B (CG3508), mRNA 
0   NM_001043265.1  CG34139-RA (CG34139), mRNA 
0   NM_135209.1  CG11320-RA (CG11320), mRNA 
0   NM_132676.2  CG12175-RB (tth), mRNA 
0   NM_057502.2  CG1322-RB, transcript variant B (zfh1), mRNA 
0   NM_170522.2  CG1322-RC, transcript variant C (zfh1), mRNA 
0   NM_170523.2  CG1322-RA, transcript variant A (zfh1), mRNA 
0   NM_136549.1  CG14752-RA (CG14752), mRNA 
0   NM_143527.2  CG9733-RA (CG9733), mRNA 
0   NM_137299.1  CG5065-RA (CG5065), mRNA 
0   NM_139391.1  CG13932-RA (CG13932), mRNA 
0   NM_080203.1  CG7620-RA (l(3)87Df), mRNA 
0   NM_139645.2  CG15021-RA (CG15021), mRNA 
0   NM_139498.1  CG9965-RA (CG9965), mRNA 
0   NM_138984.2  CG5712-RA (ACXD), mRNA 
0   NM_080338.3  CG6824-RA, transcript variant A (ovo), mRNA 
0   NM_001038742.1  CG6824-RD, transcript variant D (ovo), mRNA 
0   NM_167027.2  CG6824-RC, transcript variant C (ovo), mRNA 
0   NM_167026.2  CG6824-RB, transcript variant B (ovo), mRNA 
0   NM_132275.1  CG1994-RA (l(1)G0020), mRNA 
0   NM_169529.2  CG16901-RA, transcript variant A (sqd), mRNA 
0   NM_135618.1  CG17137-RA (Porin2), mRNA 
0   NM_136899.2  CG8453-RA (Cyp6g1), mRNA 
0   NM_206481.1  CG16901-RD, transcript variant D (sqd), mRNA 
0   NM_169528.1  CG16901-RB, transcript variant B (sqd), mRNA 
0   NM_143952.1  CG16901-RC, transcript variant C (sqd), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.