National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11349R-2 
 Symbol CG11349  Full Name CG11349 
 CG No CG11349  Old CG No CG11349 
 Synonyms CG11349 
 Accession No (Link to NCBI) NM_139651.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGGCGGACGTTTCCCATGTGA 
 Primer Seq. 3'
aatctagaggtaccTGCACGATCTGGGCGAGTAAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGGCGGACGT TTCCCATGTG AAACACCACA AGCACCAGCG NCATCATCAC TCCAGGGATC 
0061 ACGAAGATGA CGATGAGGAG TCCCATTACC TACCTCCCCA CGAGGAAAAG GAGGTGGAGC 
0121 AACCTTTTTA CAAGAAGGAG AAGCACACCA GTGAAAAGGT GGTTTACCAC AAGGTAGAGG 
0181 AGCACGAGGA GCCCAAATAC TACAAGGAGC ATCAACATGA AGAGCCCAAA AAGCAGCGAG 
0241 TGGATCACTA CCATCACTAT GACAAGAAGC CAGAAGTAAA GACCCAGCAC ATTCACTACA 
0301 AGCATAGCAA GCCCCATGTC CGTACGGATT ACAATCAGGA CTTGTTCACC CCAGCTGCTA 
0361 CCCAAGTGGT TTATCGCCGC CGTCGTCCTA GTCGAATTCT ATACTGCCAG TGCCCCCAAC 
0421 TCGGTGTTCC ACACCCACAC GCAGATCAAC GTGCAGTCCC AGGATTCGGA ATTGAATTCC 
0481 CTTACTCGCC CAGATCGTGC A 
 in silico PCR Fragment
0001 TGGCGGACGT TTCCCATGTG AAACACCACA AGCACCAGCG GCATCATCAC TCCAGGGATC 
0061 ACGAAGATGA CGATGAGGAG TCCCATTACC TACCTCCCCA CGAGGAAAAG GAGGTGGAGC 
0121 AACCTTTTTA CAAGAAGGAG AAGCACACCA GTGAAAAGGT GGTTTACCAC AAGGTAGAGG 
0181 AGCACGAGGA GCCCAAATAC TACAAGGAGC ATCAACATGA AGAGCCCAAA AAGCAGCGAG 
0241 TGGATCACTA CCATCACTAT GACAAGAAGC CAGAAGTAAA GACCCAGCAC ATTCACTACA 
0301 AGCATAGCAA GCCCCATGTC CGTACGGATT ACAATCAGGA CTTGTTCACC CCAGCTGCTA 
0361 CCCAAGTGGT TTATCGCCGC CGTCGTCCTA GTCGAATTCT ATAC-GCCAG TGCCCCCAAC 
0421 TCGGTGTTCC ACACCCACAC GCAGATCAAC GTGCAGTCCC AGGATTCGGA ATTGAATTCC 
0481 CTTACTCGCC CAGATCGTGC A 
 Assemble Data

11349R-2.IR_full       1   TGGCGGACGTTTCCCATGTGAAACACCACAAGCACCAGCGNCATCATCACTCCAGGGATC 60
                           |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
11349R-2.in silico     1   TGGCGGACGTTTCCCATGTGAAACACCACAAGCACCAGCGGCATCATCACTCCAGGGATC 60


11349R-2.IR_full       61  ACGAAGATGACGATGAGGAGTCCCATTACCTACCTCCCCACGAGGAAAAGGAGGTGGAGC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11349R-2.in silico     61  ACGAAGATGACGATGAGGAGTCCCATTACCTACCTCCCCACGAGGAAAAGGAGGTGGAGC 120


11349R-2.IR_full       121 AACCTTTTTACAAGAAGGAGAAGCACACCAGTGAAAAGGTGGTTTACCACAAGGTAGAGG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11349R-2.in silico     121 AACCTTTTTACAAGAAGGAGAAGCACACCAGTGAAAAGGTGGTTTACCACAAGGTAGAGG 180


11349R-2.IR_full       181 AGCACGAGGAGCCCAAATACTACAAGGAGCATCAACATGAAGAGCCCAAAAAGCAGCGAG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11349R-2.in silico     181 AGCACGAGGAGCCCAAATACTACAAGGAGCATCAACATGAAGAGCCCAAAAAGCAGCGAG 240


11349R-2.IR_full       241 TGGATCACTACCATCACTATGACAAGAAGCCAGAAGTAAAGACCCAGCACATTCACTACA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11349R-2.in silico     241 TGGATCACTACCATCACTATGACAAGAAGCCAGAAGTAAAGACCCAGCACATTCACTACA 300


11349R-2.IR_full       301 AGCATAGCAAGCCCCATGTCCGTACGGATTACAATCAGGACTTGTTCACCCCAGCTGCTA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11349R-2.in silico     301 AGCATAGCAAGCCCCATGTCCGTACGGATTACAATCAGGACTTGTTCACCCCAGCTGCTA 360


11349R-2.IR_full       361 CCCAAGTGGTTTATCGCCGCCGTCGTCCTAGTCGAATTCTATACTGCCAGTGCCCCCAAC 420
                           |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
11349R-2.in silico     361 CCCAAGTGGTTTATCGCCGCCGTCGTCCTAGTCGAATTCTATAC-GCCAGTGCCCCCAAC 420


11349R-2.IR_full       421 TCGGTGTTCCACACCCACACGCAGATCAACGTGCAGTCCCAGGATTCGGAATTGAATTCC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11349R-2.in silico     421 TCGGTGTTCCACACCCACACGCAGATCAACGTGCAGTCCCAGGATTCGGAATTGAATTCC 480


11349R-2.IR_full       481 CTTACTCGCCCAGATCGTGCA 501
                           |||||||||||||||||||||
11349R-2.in silico     481 CTTACTCGCCCAGATCGTGCA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_139651.1  CG11349-RA (CG11349), mRNA 
0.2   NM_001038753.1  CG11103-RB (CG11103), mRNA 
0   20  NM_132370.1  CG2989-RA (CG2989), mRNA 
0   NM_143504.2  CG7912-RA (CG7912), mRNA 
0   NM_169082.1  CG31551-RA (CG31551), mRNA 
0   NM_079768.2  CG6238-RA, transcript variant A (ssh), mRNA 
0   NM_079979.2  CG18497-RB, transcript variant B (spen), mRNA 
0   NM_164374.1  CG18497-RA, transcript variant A (spen), mRNA 
0   NM_164375.1  CG18497-RC, transcript variant C (spen), mRNA 
0   NM_137120.1  CG17386-RA (CG17386), mRNA 
0   NM_132479.2  CG1597-RA (CG1597), mRNA 
0   NM_170623.4  CG12052-RA, transcript variant A (lola), mRNA 
0   23  NM_078977.2  CG10897-RA, transcript variant A (tou), mRNA 
0   NM_141446.1  CG10055-RA (CG10055), mRNA 
0   NM_140806.1  CG14074-RA (CG14074), mRNA 
0   NM_168842.1  CG6597-RB, transcript variant B (CG6597), mRNA 
0   NM_140947.1  CG6597-RA, transcript variant A (CG6597), mRNA 
0   NM_134784.1  CG7295-RA (CG7295), mRNA 
0   16  NM_136257.2  CG8677-RA (CG8677), mRNA 
0   11  NM_140067.1  CG3654-RD (CG3654), mRNA 
0   NM_139541.1  CG12017-RA (CG12017), mRNA 
0   NM_164957.1  CG6181-RB, transcript variant B (CG6181), mRNA 
0   NM_135642.2  CG6181-RA, transcript variant A (CG6181), mRNA 
0   NM_206686.1  CG1745-RA, transcript variant A (CG1745), mRNA 
0   NM_132490.2  CG1745-RB, transcript variant B (CG1745), mRNA 
0   NM_165843.1  CG10897-RD, transcript variant D (tou), mRNA 
0   NM_165844.1  CG10897-RB, transcript variant B (tou), mRNA 
0   NM_165842.1  CG10897-RC, transcript variant C (tou), mRNA 
0   NM_166976.1  CG32791-RA (CG32791), mRNA 
0   NM_057527.3  CG6122-RA (piwi), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.