National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11335R-1 
 Symbol lox  Full Name lysyl oxidase-like 
 CG No CG11335  Old CG No CG11335 
 Synonyms DmLOXL-1, Dmloxl-1, dmlox-1, CG11335, lox, Lox 
 Accession No (Link to NCBI) NM_079868.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Lesch C, Jo J, Wu Y, Fish GS, Galko MJ.
A targeted UAS-RNAi screen in Drosophila larvae identifies wound closure genes regulating distinct cellular processes.
Genetics (2010) 186(3) 943-57 [ PubMed ID = 20813879 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GGCCAACCTCAACGTGCAGAACAACTATAGAAACATGATGGTCCGACTGGCCACTAACAA 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GGCAGCGCTCGCCGGTATTCAAGTCCTCCGCGAGGGACGCGTGGAGGTGAGCTTTGACTT 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TGGCGCCTCATGGGGTACGATCTGCAGCACTTCGTGGAGCATGCGGGAGGCAAATGTGGT 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GTGCCGACAGCTAGGATTGGGCTACGCTTCCAAGGCAAGCCAGGGAACGGAGCACGGGGA 240

                           |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| silico     241 TAGCCGGAAGTATCCCTGGGGCATGGTGGGCACTCTGTGCAG-GGGAACCGAGCGTCGCC 300

                           |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| silico     301 TAGCCGACTGCATCCGGGAGTCCCACTACCCGAACCTCTGCAATGCCAGAAACCATAATG 360

                           ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| silico     361 TCAGCATTGCGGCCTGTGTTAGCCATTCGGCTGACCTGGAGATCGGACTGG-TGGACATC 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GAGAGAACCGCCCGCCTGGAGGCCGTGCCCATGTCGCGGCTCACATGCGCCATGGAAGAG 480

11335R-1.IR_full       481 CACTGTGTTTCCGCCGACGCTT 502
                           |||||||||||||||||||||| silico     481 CACTGTGTTTCCGCCGACGCTT 502

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079868.2  CG11335-RA (lox), mRNA 
0   NM_138031.1  CG3173-RA (CG3173), mRNA 
0   NM_136888.2  CG12367-RA (CG12367), mRNA 
0   14  24  NM_079082.3  CG4402-RA (lox2), mRNA 
0   NM_137163.3  CG10255-RA (Lap1), mRNA 
0   NM_142837.2  CG17141-RA (CG17141), mRNA 
0   NM_153772.1  CG13867-RA (MED8), mRNA 
0   NM_170348.1  CG31055-RB, transcript variant B (CG31055), mRNA 
0   NM_170347.1  CG31055-RC, transcript variant C (CG31055), mRNA 
0   NM_170346.1  CG31055-RA, transcript variant A (CG31055), mRNA 
0   NM_167706.1  CG1702-RA (CG1702), mRNA 
0   NM_169569.1  CG31533-RA (CG31533), mRNA 
0   NM_169309.3  CG8478-RA, transcript variant A (CG8478), mRNA 
0   NM_141684.3  CG8478-RB, transcript variant B (CG8478), mRNA 
0   NM_079063.2  CG10794-RA (DptB), mRNA 
0   NM_143717.1  CG10840-RB (eIF5B), mRNA 
0   NM_057716.3  CG8705-RA, transcript variant A (pnut), mRNA 
0   NM_165597.1  CG8705-RB, transcript variant B (pnut), mRNA 
0   NM_139540.1  CG14960-RA (CG14960), mRNA 
0   NM_078509.2  CG3929-RA (dx), mRNA 
0   NM_167401.1  CG1517-RB, transcript variant B (na), mRNA 
0   NM_167402.1  CG1517-RC, transcript variant C (na), mRNA 
0   NM_057992.2  CG5562-RA (gbb), mRNA 
0   NM_165227.1  CG7100-RD, transcript variant D (CadN), mRNA 
0   NM_165228.1  CG7100-RC, transcript variant C (CadN), mRNA 
0   NM_165229.1  CG7100-RA, transcript variant A (CadN), mRNA 
0   NM_165230.1  CG7100-RG, transcript variant G (CadN), mRNA 
0   NM_165231.1  CG7100-RE, transcript variant E (CadN), mRNA 
0   NM_001032108.1  CG7100-RJ, transcript variant J (CadN), mRNA 
0   NM_001032109.1  CG7100-RI, transcript variant I (CadN), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.