National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11333R-2 
 Symbol CG11333  Full Name CG11333 
 CG No CG11333  Old CG No CG11333 
 Synonyms BcDNA:AT02774, CG11333 
 Accession No (Link to NCBI) NM_143612.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGCCCTCGAAAACGCTCTTCA 
 Primer Seq. 3'
aatctagaggtaccGTTGTTCTTGTCCCCCAGCAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGCCCTCGAA AACGCTCTTC ATGCTGTGCG ACGTGCAGGA GAAGTTCAAG CCGGCCATTC 
0061 CGCTGCTAAG TTCGCTCATC GAAAACACTA CTAAACTGCT GGCAGCCGGC AAGGTCTTCC 
0121 AAGTGCCACT GCTGGTCACC GAGCAGTATC CCGAGAGGCT GGGCAAGACC GTTTGTGAGT 
0181 TGGACATCAA GCATGCCTGT GCCAATATTT CCAAGACCAT GTTCTCTATG CTGGTGGAGC 
0241 CGGTACGTAA GAGTATGACT GATATCTTCG GTGGCAAGCC CAAGACGGTG GTGCTTTTCG 
0301 GTCTGGAGAC ACACGTCTGT GTGGAGCAGA CGGCCTTCGA CCTGGTAAAT GATGAAATCG 
0361 ATGTCTGGCT GGTGGCCGAC TGCTGTGCGT CGCGTCACAA TCAGGATCGG GACTTGGCCT 
0421 TGGAGCGCCT GCGTCACATT GGCTGCAACA TAGCAACTTC CGAGAGTGTG ATATTTAATC 
0481 TGCTGGGGGA CAAGAACAAC  
 in silico PCR Fragment
0001 TGCCCTCGAA AACGCTCTTC ATGCTGTGCG ACGTGCAGGA GAAGTTCAAG CCGGCCATTC 
0061 CGCTGCTAAG TTCGCTCATC GAAAACACTA CTAAACTGCT GGCAGCCGGC AAGGTCTTCC 
0121 AAGTGCCACT GCTGGTCACC GAGCAGTATC CCGAGAGGCT GGGCAAGACC GTTTGTGAGT 
0181 TGGACATCAA GCATGCCTGT GCCAATATTT CCAAGACCAT GTTCTCTATG CTGGTGGAGC 
0241 CGGTACGTAA GAGTATGACT GATATCTTCG GTGGCAAGCC CAAGACGGTG GTGCTTTTCG 
0301 GTCTGGAGAC ACACGTCTGT GTGGAGCAGA CGGCCTTCGA CCTGGTAAAT GATGAAATCG 
0361 ATGTCTGGCT GGTGGCCGAC TGCTGTGCGT CGCGTCACAA TCAGGATCGG GACTTGGCCT 
0421 TGGAGCGCCT GCGTCACATT GGCTGCAACA TAGCAACTTC CGAGAGTGTG ATATTTAATC 
0481 TGCTGGGGGA CAAGAACAAC  
 Assemble Data

11333R-2.IR_full       1   TGCCCTCGAAAACGCTCTTCATGCTGTGCGACGTGCAGGAGAAGTTCAAGCCGGCCATTC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11333R-2.in silico     1   TGCCCTCGAAAACGCTCTTCATGCTGTGCGACGTGCAGGAGAAGTTCAAGCCGGCCATTC 60


11333R-2.IR_full       61  CGCTGCTAAGTTCGCTCATCGAAAACACTACTAAACTGCTGGCAGCCGGCAAGGTCTTCC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11333R-2.in silico     61  CGCTGCTAAGTTCGCTCATCGAAAACACTACTAAACTGCTGGCAGCCGGCAAGGTCTTCC 120


11333R-2.IR_full       121 AAGTGCCACTGCTGGTCACCGAGCAGTATCCCGAGAGGCTGGGCAAGACCGTTTGTGAGT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11333R-2.in silico     121 AAGTGCCACTGCTGGTCACCGAGCAGTATCCCGAGAGGCTGGGCAAGACCGTTTGTGAGT 180


11333R-2.IR_full       181 TGGACATCAAGCATGCCTGTGCCAATATTTCCAAGACCATGTTCTCTATGCTGGTGGAGC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11333R-2.in silico     181 TGGACATCAAGCATGCCTGTGCCAATATTTCCAAGACCATGTTCTCTATGCTGGTGGAGC 240


11333R-2.IR_full       241 CGGTACGTAAGAGTATGACTGATATCTTCGGTGGCAAGCCCAAGACGGTGGTGCTTTTCG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11333R-2.in silico     241 CGGTACGTAAGAGTATGACTGATATCTTCGGTGGCAAGCCCAAGACGGTGGTGCTTTTCG 300


11333R-2.IR_full       301 GTCTGGAGACACACGTCTGTGTGGAGCAGACGGCCTTCGACCTGGTAAATGATGAAATCG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11333R-2.in silico     301 GTCTGGAGACACACGTCTGTGTGGAGCAGACGGCCTTCGACCTGGTAAATGATGAAATCG 360


11333R-2.IR_full       361 ATGTCTGGCTGGTGGCCGACTGCTGTGCGTCGCGTCACAATCAGGATCGGGACTTGGCCT 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11333R-2.in silico     361 ATGTCTGGCTGGTGGCCGACTGCTGTGCGTCGCGTCACAATCAGGATCGGGACTTGGCCT 420


11333R-2.IR_full       421 TGGAGCGCCTGCGTCACATTGGCTGCAACATAGCAACTTCCGAGAGTGTGATATTTAATC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11333R-2.in silico     421 TGGAGCGCCTGCGTCACATTGGCTGCAACATAGCAACTTCCGAGAGTGTGATATTTAATC 480


11333R-2.IR_full       481 TGCTGGGGGACAAGAACAAC 500
                           ||||||||||||||||||||
11333R-2.in silico     481 TGCTGGGGGACAAGAACAAC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_143612.2  CG11333-RA (CG11333), mRNA 
0   NM_166972.1  CG12535-RB, transcript variant B (CG12535), mRNA 
0   NM_130699.1  CG12535-RA, transcript variant A (CG12535), mRNA 
0   NM_143406.1  CG11843-RA (CG11843), mRNA 
0   NM_167282.2  CG1725-RA, transcript variant A (dlg1), mRNA 
0   NM_078565.3  CG1725-RD, transcript variant D (dlg1), mRNA 
0   NM_206682.2  CG1725-RG, transcript variant G (dlg1), mRNA 
0   NM_206684.2  CG1725-RE, transcript variant E (dlg1), mRNA 
0   NM_206681.2  CG1725-RH, transcript variant H (dlg1), mRNA 
0   NM_206683.2  CG1725-RB, transcript variant B (dlg1), mRNA 
0   NM_167281.1  CG1725-RF, transcript variant F (dlg1), mRNA 
0   NM_135614.2  CG17134-RA (CG17134), mRNA 
0   NM_138988.2  CG11405-RA (A3-3), mRNA 
0   NM_134533.2  CG9578-RA (CG9578), mRNA 
0   NM_137156.2  CG10242-RA (Cyp6a23), mRNA 
0   NM_140806.1  CG14074-RA (CG14074), mRNA 
0   NM_140569.2  CG5841-RA (mib1), mRNA 
0   NM_167340.1  CG32648-RA (Pde9), mRNA 
0   NM_206050.1  CG11140-RE, transcript variant E (Aldh-III), mRNA 
0   NM_165531.1  CG11140-RF, transcript variant F (Aldh-III), mRNA 
0   NM_165532.1  CG11140-RG, transcript variant G (Aldh-III), mRNA 
0   NM_165529.1  CG11140-RC, transcript variant C (Aldh-III), mRNA 
0   NM_165528.1  CG11140-RB, transcript variant B (Aldh-III), mRNA 
0   NM_165526.1  CG11140-RI, transcript variant I (Aldh-III), mRNA 
0   NM_165527.1  CG11140-RA, transcript variant A (Aldh-III), mRNA 
0   NM_165530.1  CG11140-RD, transcript variant D (Aldh-III), mRNA 
0   NM_137893.2  CG30190-RA (CG30190), mRNA 
0   NM_136856.1  CG12444-RB, transcript variant B (Tango3), mRNA 
0   NM_135029.2  CG3036-RA (CG3036), mRNA 
0   NM_165848.1  CG12444-RA, transcript variant A (Tango3), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.