National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11331R-1 
 Symbol Spn27A  Full Name Serpin-27A 
 CG No CG11331  Old CG No CG11331 
 Synonyms spn27A, CG11331, EST1, Spn27A 
 Accession No (Link to NCBI) NM_143767.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Nakaoka T, Iga M, Yamada T, Koujima I, Takeshima M, Zhou X, Suzuki Y, Ogihara MH, Kataoka H.
Deep sequencing of the prothoracic gland transcriptome reveals new players in insect ecdysteroidogenesis.
PLoS ONE (2017) 12(3) e0172951 [ PubMed ID = 28257485 ] [ RRC reference ]

Minami R, Sato C, Yamahama Y, Kubo H, Hariyama T, Kimura KI.
An RNAi Screen for Genes Involved in Nanoscale Protrusion Formation on Corneal Lens in Drosophila melanogaster.
Zool. Sci. (2016) 33(6) 583-591 [ PubMed ID = 27927092 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCAAAGATGGGCGGAAATTTGG 
 Primer Seq. 3'
aatctagaggtaccGATGAAGCTGTCCGTGAAGAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CAAAGATGGG CGGAAATTTG GCAGTGATgC TGCTGTCGCT GTTTTTGAGT GCGTTAgcCN 
0061 CGGGCAACGG CAACTCCATA CCGACGACCA CGACGCCCCA GGgcGTATNT CGAAACCCGT 
0121 ACGGACAAGC TGCCCGGTGG CGCTGCCAGC GTGCCCAGTG GAGCGGGTAT CTACGACGAT 
0181 ATAGATACCT TTGTGCCCTT CCGGAGCGAC TCGCACGATC CGTTCTCATG GCATCTACTG 
0241 AAGACGGTGC TGCAGAACGA GACAGCCGAC AAGAATGTGA TCATCTCGCC GTTCTCCGTC 
0301 AAACTGGTGC TGGcCCTGCT GGCTGANGcG NCCGGAGCCG GAACCCAGAC GCAAGTGGAG 
0361 CTGGCCAACA CGCAAACAGA CATTCGATCG CAAAATAATG TGCGGGAGTT CTACCGCAAG 
0421 ACACTTAATT CCTTCAAGAA GGAGAACCAG CTCCACGAGA CGCTCAGTGT GCGCACCAAG 
0481 CTCTTCACGG ACAGCTTCAT C 
 in silico PCR Fragment
0001 CAAAGATGGG CGGAAATTTG GCAGTGATGC TGCTGTCGCT GTTTTTGAGT GCGTTAGCCA 
0061 CGGGCAACGG CAACTCCATA CCGACGACCA CGACGCCCCA GGGCGTAT-T CGAAACCCGT 
0121 ACGGACAAGC TGCCCGGTGG CGCTGCCAGC GTGCCCAGTG GAGCGGGTAT CTACGACGAT 
0181 ATAGATACCT TTGTGCCCTT CCGGAGCGAC TCGCACGATC CGTTCTCATG GCATCTACTG 
0241 AAGACGGTGC TGCAGAACGA GACAGCCGAC AAGAATGTGA TCATCTCGCC GTTCTCCGTC 
0301 AAACTGGTGC TGGCCCTGCT GGCTGAGGCG GCCGGAGCCG GAACCCAGAC GCAAGTGGAG 
0361 CTGGCCAACA CGCAAACAGA CATTCGATCG CAAAATAATG TGCGGGAGTT CTACCGCAAG 
0421 ACACTTAATT CCTTCAAGAA GGAGAACCAG CTCCACGAGA CGCTCAGTGT GCGCACCAAG 
0481 CTCTTCACGG ACAGCTTCAT C 
 Assemble Data

11331R-1.IR_full       1   CAAAGATGGGCGGAAATTTGGCAGTGATGCTGCTGTCGCTGTTTTTGAGTGCGTTAGCCN 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| 
11331R-1.in silico     1   CAAAGATGGGCGGAAATTTGGCAGTGATGCTGCTGTCGCTGTTTTTGAGTGCGTTAGCCA 60


11331R-1.IR_full       61  CGGGCAACGGCAACTCCATACCGACGACCACGACGCCCCAGGGCGTATNTCGAAACCCGT 120
                           |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
11331R-1.in silico     61  CGGGCAACGGCAACTCCATACCGACGACCACGACGCCCCAGGGCGTAT-TCGAAACCCGT 120


11331R-1.IR_full       121 ACGGACAAGCTGCCCGGTGGCGCTGCCAGCGTGCCCAGTGGAGCGGGTATCTACGACGAT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11331R-1.in silico     121 ACGGACAAGCTGCCCGGTGGCGCTGCCAGCGTGCCCAGTGGAGCGGGTATCTACGACGAT 180


11331R-1.IR_full       181 ATAGATACCTTTGTGCCCTTCCGGAGCGACTCGCACGATCCGTTCTCATGGCATCTACTG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11331R-1.in silico     181 ATAGATACCTTTGTGCCCTTCCGGAGCGACTCGCACGATCCGTTCTCATGGCATCTACTG 240


11331R-1.IR_full       241 AAGACGGTGCTGCAGAACGAGACAGCCGACAAGAATGTGATCATCTCGCCGTTCTCCGTC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11331R-1.in silico     241 AAGACGGTGCTGCAGAACGAGACAGCCGACAAGAATGTGATCATCTCGCCGTTCTCCGTC 300


11331R-1.IR_full       301 AAACTGGTGCTGGCCCTGCTGGCTGANGCGNCCGGAGCCGGAACCCAGACGCAAGTGGAG 360
                           |||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||
11331R-1.in silico     301 AAACTGGTGCTGGCCCTGCTGGCTGAGGCGGCCGGAGCCGGAACCCAGACGCAAGTGGAG 360


11331R-1.IR_full       361 CTGGCCAACACGCAAACAGACATTCGATCGCAAAATAATGTGCGGGAGTTCTACCGCAAG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11331R-1.in silico     361 CTGGCCAACACGCAAACAGACATTCGATCGCAAAATAATGTGCGGGAGTTCTACCGCAAG 420


11331R-1.IR_full       421 ACACTTAATTCCTTCAAGAAGGAGAACCAGCTCCACGAGACGCTCAGTGTGCGCACCAAG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11331R-1.in silico     421 ACACTTAATTCCTTCAAGAAGGAGAACCAGCTCCACGAGACGCTCAGTGTGCGCACCAAG 480


11331R-1.IR_full       481 CTCTTCACGGACAGCTTCATC 501
                           |||||||||||||||||||||
11331R-1.in silico     481 CTCTTCACGGACAGCTTCATC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_143767.2  CG11331-RA (Spn27A), mRNA 
0   NM_132494.2  CG1749-RA (CG1749), mRNA 
0   50  NM_168571.2  CG32133-RA (CG32133), mRNA 
0   NM_080066.2  CG12172-RA (Spn43Aa), mRNA 
0   21  NM_078797.2  CG13109-RA (tai), mRNA 
0   NM_169293.1  CG8208-RA, transcript variant A (MBD-like), mRNA 
0   NM_167143.1  CG32858-RB, transcript variant B (sn), mRNA 
0   NM_167142.1  CG32858-RA, transcript variant A (sn), mRNA 
0   NM_142466.2  CG12333-RA (CG12333), mRNA 
0   NM_134511.1  CG12702-RA (CG12702), mRNA 
0   NM_137094.1  CG8394-RA (CG8394), mRNA 
0   22  NM_079736.2  CG10868-RA, transcript variant A (orb), mRNA 
0   NM_132350.1  CG15321-RA (CG15321), mRNA 
0   11  NM_079453.2  CG6975-RA (gig), mRNA 
0   NM_142521.1  CG6026-RA (CG6026), mRNA 
0   NM_140315.3  CG4357-RA, transcript variant A (Ncc69), mRNA 
0   NM_206344.1  CG4357-RB, transcript variant B (Ncc69), mRNA 
0   NM_134540.1  CG15462-RA (CG15462), mRNA 
0   17  NM_135954.1  CG13260-RA (CG13260), mRNA 
0   NM_140669.2  CG9715-RA (CG9715), mRNA 
0   NM_140466.1  CG5295-RA (CG5295), mRNA 
0   NM_135176.2  CG9506-RA (slam), mRNA 
0   NM_165644.1  CG8069-RB, transcript variant B (Phax), mRNA 
0   NM_143754.2  CG18660-RC, transcript variant C (Nckx30C), mRNA 
0   NM_164870.1  CG18660-RB, transcript variant B (Nckx30C), mRNA 
0   NM_164869.1  CG18660-RA, transcript variant A (Nckx30C), mRNA 
0   NM_136612.2  CG8069-RA, transcript variant A (Phax), mRNA 
0   NM_078932.2  CG17853-RA (Or43b), mRNA 
0   NM_078607.2  CG6157-RA (dah), mRNA 
0   NM_001014485.1  CG33515-RA (CG33515), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.