National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11327R-1 
 Symbol CG11327  Full Name CG11327 
 CG No CG11327  Old CG No CG11327 
 Synonyms CG11327 
 Accession No (Link to NCBI) NM_135221.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATCCCAGGAAGAGCTGAAGCG 
 Primer Seq. 3'
aatctagaggtaccCCTGGTCAATATCATCGGGCA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATCCCAGGAA GAGCTGAAGC GGACTGAGAA CAACAAGAAT GTGAAAAACT CCGAAGAATG 
0061 TCAAGCAATG GAGGATGATG TGGACGCGGT TGTCCCATCT TCGTCGGAGA GTGAGCTGCG 
0121 GCCTCGCAGT TCGGGAGTTA GGCCCACTAA AATTCCGGCT CCACTTTTCT TGGGACCCAG 
0181 TGCCAGCAGC CGGATCTACA GTTCACTGAT GCCCGAGAGA AAGCGACGCT CCTCCATGGA 
0241 AAGTCAACAG ATGGCCGACG ATTCTGGCAT CAATTTGGAT TGCTCCACGG ACGAGCAGCA 
0301 GACTACGCTG TCGGCCAGAC CGAGTCCAAT GCTGCAGCCG ATGCTCGACA GGATTCCGGA 
0361 CACTAGCAGC GAGTTGGAGC TCCGACTGGC AGAGGAGCAG ACTCTCAAGG AACTTCAACG 
0421 CGTCGTCGCC GAAATGGAGG CTGATGTGGC TTTTAATAAT TTAGATATGC AAAATCTACT 
0481 GCCCGATGAT ATTGACCAGG  
 in silico PCR Fragment
0001 ATCCCAGGAA GAGCTGAAGC GGACTGAGAA CAACAAGAAT GTGAAAAACT CCGAAGAATG 
0061 TCAATCAATG GAAAACGATG TGGACGCGGT TGTCCCATCT TCGTCGGAGA GTGAGCTGCG 
0121 GCCTCGCAGT TCGGGAGTTA GGCCCACTAA AATTCCGGCT CCACTTTTCT TGGGACCCAG 
0181 TGCCAGCAGC CGGATCTACA GTTCACTGAT GCCCGAGAGA AAGCGACGCT CCTCCATGGA 
0241 AAGTCAACAG ATGGCCGACG ATTCTGGCAT CAATTTGGAT TGCTCCACGG ACGAGCAGCA 
0301 GACTACGCTG TCGGCCAGAC CGAGTCCAAT GCTGCAGCCG ATGCTCGACA GGATTCCGGA 
0361 CACTAGCAGC GAGTTGGAGC TCCGACTGGC AGAGGAGCAG ACTCTCAAGG AACTTCAACG 
0421 CGTCGTCGCC GAAATGGAGG CTGATGTGGC TTTTAATAAT TTAGATATGC AAAATCTACT 
0481 GCCCGATGAT ATTGACCAGG  
 Assemble Data

11327R-1.IR_full       1   ATCCCAGGAAGAGCTGAAGCGGACTGAGAACAACAAGAATGTGAAAAACTCCGAAGAATG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11327R-1.in silico     1   ATCCCAGGAAGAGCTGAAGCGGACTGAGAACAACAAGAATGTGAAAAACTCCGAAGAATG 60


11327R-1.IR_full       61  TCAAGCAATGGAGGATGATGTGGACGCGGTTGTCCCATCTTCGTCGGAGAGTGAGCTGCG 120
                           |||| |||||||  | ||||||||||||||||||||||||||||||||||||||||||||
11327R-1.in silico     61  TCAATCAATGGAAAACGATGTGGACGCGGTTGTCCCATCTTCGTCGGAGAGTGAGCTGCG 120


11327R-1.IR_full       121 GCCTCGCAGTTCGGGAGTTAGGCCCACTAAAATTCCGGCTCCACTTTTCTTGGGACCCAG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11327R-1.in silico     121 GCCTCGCAGTTCGGGAGTTAGGCCCACTAAAATTCCGGCTCCACTTTTCTTGGGACCCAG 180


11327R-1.IR_full       181 TGCCAGCAGCCGGATCTACAGTTCACTGATGCCCGAGAGAAAGCGACGCTCCTCCATGGA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11327R-1.in silico     181 TGCCAGCAGCCGGATCTACAGTTCACTGATGCCCGAGAGAAAGCGACGCTCCTCCATGGA 240


11327R-1.IR_full       241 AAGTCAACAGATGGCCGACGATTCTGGCATCAATTTGGATTGCTCCACGGACGAGCAGCA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11327R-1.in silico     241 AAGTCAACAGATGGCCGACGATTCTGGCATCAATTTGGATTGCTCCACGGACGAGCAGCA 300


11327R-1.IR_full       301 GACTACGCTGTCGGCCAGACCGAGTCCAATGCTGCAGCCGATGCTCGACAGGATTCCGGA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11327R-1.in silico     301 GACTACGCTGTCGGCCAGACCGAGTCCAATGCTGCAGCCGATGCTCGACAGGATTCCGGA 360


11327R-1.IR_full       361 CACTAGCAGCGAGTTGGAGCTCCGACTGGCAGAGGAGCAGACTCTCAAGGAACTTCAACG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11327R-1.in silico     361 CACTAGCAGCGAGTTGGAGCTCCGACTGGCAGAGGAGCAGACTCTCAAGGAACTTCAACG 420


11327R-1.IR_full       421 CGTCGTCGCCGAAATGGAGGCTGATGTGGCTTTTAATAATTTAGATATGCAAAATCTACT 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11327R-1.in silico     421 CGTCGTCGCCGAAATGGAGGCTGATGTGGCTTTTAATAATTTAGATATGCAAAATCTACT 480


11327R-1.IR_full       481 GCCCGATGATATTGACCAGG 500
                           ||||||||||||||||||||
11327R-1.in silico     481 GCCCGATGATATTGACCAGG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135221.2  CG11327-RA, transcript variant A (CG11327), mRNA 
100   482  NM_175979.1  CG11327-RB, transcript variant B (CG11327), mRNA 
71.36   344  NM_001042875.1  CG11327-RC, transcript variant C (CG11327), mRNA 
0   NM_079470.2  CG10564-RA (Ac78C), mRNA 
0   NM_001015159.1  CG12449-PB.3 (CG12449), mRNA 
0   NM_001015162.1  CG12449-PF.3 (CG12449), mRNA 
0   NM_001015158.1  CG12449-PD.3 (CG12449), mRNA 
0   NM_001015157.1  CG12449-PA.3 (CG12449), mRNA 
0   NM_001015161.1  CG12449-PE.3 (CG12449), mRNA 
0   NM_001015160.1  CG12449-PC.3 (CG12449), mRNA 
0   14  NM_134544.1  CG11734-RB (HERC2), mRNA 
0   NM_135357.3  CG8183-RA, transcript variant A (Khc-73), mRNA 
0   NM_176176.1  CG8183-RB, transcript variant B (Khc-73), mRNA 
0   NM_137827.1  CG10344-RB, transcript variant B (CG10344), mRNA 
0   NM_166534.1  CG10344-RA, transcript variant A (CG10344), mRNA 
0   NM_164542.3  CG3234-RB, transcript variant B (tim), mRNA 
0   NM_164540.2  CG3234-RD, transcript variant D (tim), mRNA 
0   NM_001038783.1  CG3234-RF, transcript variant F (tim), mRNA 
0   NM_001014463.1  CG3234-RE, transcript variant E (tim), mRNA 
0   NM_078744.3  CG3234-RA, transcript variant A (tim), mRNA 
0   NM_134892.2  CG17264-RA (CG17264), mRNA 
0   NM_135977.1  CG15133-RA (CG15133), mRNA 
0   NM_164541.3  CG3234-RC, transcript variant C (tim), mRNA 
0   NM_057385.4  CG11121-RA (so), mRNA 
0   NM_135762.2  CG16975-RB, transcript variant B (CG16975), mRNA 
0   NM_170053.2  CG17894-RC, transcript variant C (cnc), mRNA 
0   10  NM_057241.2  CG7210-RB, transcript variant B (kel), mRNA 
0   10  NM_165242.1  CG7210-RA, transcript variant A (kel), mRNA 
0   30  NM_079919.2  CG5700-RB (prc), mRNA 
0   15  NM_132457.1  CG11122-RA (CG11122), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.