National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11326R-3 
 Symbol Tsp  Full Name Thrombospondin 
 CG No CG11326  Old CG No CG11326 
 Synonyms CT31613, tsp, CG11326, SP295, D-TSP, DTSP, Tsp 
 Accession No (Link to NCBI) NM_078771.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GGACATTAGTGCGAACGGAGCCACCGAGTCGCGCAACTTCGAGATACCCAACATCAATGA 60

                           |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| silico     61  GACAAGCACCATCCGATCCCTGGCACTGCAGTTCTCCAAGAA-TCGCATAACGCTCCATG 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TGGACTGCAAGGCGAGCACGCATCACGACATCGACATGAACCTGGCCAAGCTGTACACCC 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 AGATGGACGATCCGGTGATCAAGCTGTTCCGTGAGCGCAAGTATCCCCTTCACTTCGACG 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GGGACATGGAGCACTCCCTGCAGCGGGCCAATTGCCAGAAGGGCAACCATCGTCGTGGCA 300

                           ||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 ATC-GTCG-CATGCTGCGCAACAAGATCACCGAGCGTGAGAAGAACAAGAAGCGCGATGT 360

                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GCGCGGCTGGTATGAGCCAACGATCGCCCGGGAAGGAGTCGTGGATCACAGACACCAGG 419

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   398  NM_078771.2  CG11326-RA, transcript variant A (Tsp), mRNA 
100   398  NM_164703.1  CG11326-RD, transcript variant D (Tsp), mRNA 
100   398  NM_164702.1  CG11326-RC, transcript variant C (Tsp), mRNA 
100   398  NM_164704.1  CG11326-RE, transcript variant E (Tsp), mRNA 
0   NM_057857.4  CG8749-RA (snRNP70K), mRNA 
0   NM_001043199.1  CG34112-RA (CG34112), mRNA 
0   NM_206622.2  CG32776-RB, transcript variant B (CG32776), mRNA 
0   NM_001038740.1  CG32776-RD, transcript variant D (CG32776), mRNA 
0   NM_166996.2  CG32776-RA, transcript variant A (CG32776), mRNA 
0   NM_001038741.1  CG32776-RC, transcript variant C (CG32776), mRNA 
0   NM_140745.1  CG6052-RA (CG6052), mRNA 
0   NM_079491.2  CG5723-RB (Ten-m), mRNA 
0   NM_057938.3  CG3093-RA (dor), mRNA 
0   NM_140049.2  CG3672-RA (CG3672), mRNA 
0   NM_001014571.1  CG33556-RA (form3), mRNA 
0   NM_134933.1  CG2774-RA (CG2774), mRNA 
0   NM_141608.2  CG18005-RA (CG18005), mRNA 
0   NM_001042864.1  CG9660-RE, transcript variant E (toc), mRNA 
0   NM_164524.1  CG9660-RD, transcript variant D (toc), mRNA 
0   NM_057805.2  CG9660-RA, transcript variant A (toc), mRNA 
0   NM_168692.2  CG32170-RA (CG32170), mRNA 
0   NM_132660.2  CG1716-RA (CG1716), mRNA 
0   NM_080313.2  CG9659-RC, transcript variant C (egh), mRNA 
0   NM_166946.1  CG9659-RB, transcript variant B (egh), mRNA 
0   13  NM_176557.1  CG33106-RB, transcript variant B (mask), mRNA 
0   13  NM_176556.1  CG33106-RA, transcript variant A (mask), mRNA 
0   NM_144350.1  CG7487-RA (RecQ4), mRNA 
0   NM_137959.1  CG5360-RA (CG5360), mRNA 
0   NM_139541.1  CG12017-RA (CG12017), mRNA 
0   NM_142297.2  CG14900-RA (Cad89D), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.