National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11326R-2 
 Symbol Tsp  Full Name Thrombospondin 
 CG No CG11326  Old CG No CG11326 
 Synonyms CT31613, tsp, CG11326, SP295, D-TSP, DTSP, Tsp 
 Accession No (Link to NCBI) NM_078771.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Perkins AD, Lee MJ, Tanentzapf G.
The systematic identification of cytoskeletal genes required for Drosophila melanogaster muscle maintenance.
Sci Data (2014) 1 140002 [ PubMed ID = 25977760 ] [ RRC reference ]

Fairchild MJ, Islam F, Tanentzapf G.
Identification of genetic networks that act in the somatic cells of the testis to mediate the developmental program of spermatogenesis.
PLoS Genet. (2017) 13(9) e1007026 [ PubMed ID = 28957323 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGACATTAGTGCGAACGGAGC 
 Primer Seq. 3'
aatctagaggtaccCCTGGTGTCTGTGATCCACGA 
 Predicted Fragment Size
416 
 IR fragment full Seq
0001 GGACATTAGT GCGAACGGAG CCACCGAGTC GCGCAACTTC GAGATACCCA ACATCAATGA 
0061 GACAAGCACC ATCCGATCCC TGGCACTGCA GTTCTCCAAG AATTCGCATA ACGCTCCATG 
0121 TGGACTGCAA GGCGAGCACG CATCACGACA TCGACATGAA CCTGGCCAAG CTGTACACCC 
0181 AGATGGACGA TCCGGTGATC AAGCTGTTCC GTGAGCGCAA GTATCCCCTT CACTTCGACG 
0241 GGGACATGGA GCACTCCCTG CAGCGGGCCA ATTGCCAGAA GGGCAACCAT CGTCGTGGCA 
0301 ATCNGTCGNC ATGCTGCGCA ACAAGATCAC CGAGCGTGAG AAGAACAAGA AGCGCGATGT 
0361 GCGCGGCTGG TATGAGCCAA CGATCGCCCG GGAAGGAGTC GTGGATCACA GACACCAGG 
 in silico PCR Fragment
0001 GGACATTAGT GCGAACGGAG CCACCGAGTC GCGCAACTTC GAGATACCCA ACATCAATGA 
0061 GACAAGCACC ATCCGATCCC TGGCACTGCA GTTCTCCAAG AA-TCGCATA ACGCTCCATG 
0121 TGGACTGCAA GGCGAGCACG CATCACGACA TCGACATGAA CCTGGCCAAG CTGTACACCC 
0181 AGATGGACGA TCCGGTGATC AAGCTGTTCC GTGAGCGCAA GTATCCCCTT CACTTCGACG 
0241 GGGACATGGA GCACTCCCTG CAGCGGGCCA ATTGCCAGAA GGGCAACCAT CGTCGTGGCA 
0301 ATC-GTCG-C ATGCTGCGCA ACAAGATCAC CGAGCGTGAG AAGAACAAGA AGCGCGATGT 
0361 GCGCGGCTGG TATGAGCCAA CGATCGCCCG GGAAGGAGTC GTGGATCACA GACACCAGG 
 Assemble Data

11326R-2.IR_full       1   GGACATTAGTGCGAACGGAGCCACCGAGTCGCGCAACTTCGAGATACCCAACATCAATGA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11326R-2.in silico     1   GGACATTAGTGCGAACGGAGCCACCGAGTCGCGCAACTTCGAGATACCCAACATCAATGA 60


11326R-2.IR_full       61  GACAAGCACCATCCGATCCCTGGCACTGCAGTTCTCCAAGAATTCGCATAACGCTCCATG 120
                           |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
11326R-2.in silico     61  GACAAGCACCATCCGATCCCTGGCACTGCAGTTCTCCAAGAA-TCGCATAACGCTCCATG 120


11326R-2.IR_full       121 TGGACTGCAAGGCGAGCACGCATCACGACATCGACATGAACCTGGCCAAGCTGTACACCC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11326R-2.in silico     121 TGGACTGCAAGGCGAGCACGCATCACGACATCGACATGAACCTGGCCAAGCTGTACACCC 180


11326R-2.IR_full       181 AGATGGACGATCCGGTGATCAAGCTGTTCCGTGAGCGCAAGTATCCCCTTCACTTCGACG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11326R-2.in silico     181 AGATGGACGATCCGGTGATCAAGCTGTTCCGTGAGCGCAAGTATCCCCTTCACTTCGACG 240


11326R-2.IR_full       241 GGGACATGGAGCACTCCCTGCAGCGGGCCAATTGCCAGAAGGGCAACCATCGTCGTGGCA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11326R-2.in silico     241 GGGACATGGAGCACTCCCTGCAGCGGGCCAATTGCCAGAAGGGCAACCATCGTCGTGGCA 300


11326R-2.IR_full       301 ATCNGTCGNCATGCTGCGCAACAAGATCACCGAGCGTGAGAAGAACAAGAAGCGCGATGT 360
                           ||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||
11326R-2.in silico     301 ATC-GTCG-CATGCTGCGCAACAAGATCACCGAGCGTGAGAAGAACAAGAAGCGCGATGT 360


11326R-2.IR_full       361 GCGCGGCTGGTATGAGCCAACGATCGCCCGGGAAGGAGTCGTGGATCACAGACACCAGG 419
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11326R-2.in silico     361 GCGCGGCTGGTATGAGCCAACGATCGCCCGGGAAGGAGTCGTGGATCACAGACACCAGG 419

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   398  NM_078771.2  CG11326-RA, transcript variant A (Tsp), mRNA 
100   398  NM_164703.1  CG11326-RD, transcript variant D (Tsp), mRNA 
100   398  NM_164702.1  CG11326-RC, transcript variant C (Tsp), mRNA 
100   398  NM_164704.1  CG11326-RE, transcript variant E (Tsp), mRNA 
0   NM_057857.4  CG8749-RA (snRNP70K), mRNA 
0   NM_001043199.1  CG34112-RA (CG34112), mRNA 
0   NM_206622.2  CG32776-RB, transcript variant B (CG32776), mRNA 
0   NM_001038740.1  CG32776-RD, transcript variant D (CG32776), mRNA 
0   NM_166996.2  CG32776-RA, transcript variant A (CG32776), mRNA 
0   NM_001038741.1  CG32776-RC, transcript variant C (CG32776), mRNA 
0   NM_140745.1  CG6052-RA (CG6052), mRNA 
0   NM_079491.2  CG5723-RB (Ten-m), mRNA 
0   NM_057938.3  CG3093-RA (dor), mRNA 
0   NM_140049.2  CG3672-RA (CG3672), mRNA 
0   NM_001014571.1  CG33556-RA (form3), mRNA 
0   NM_134933.1  CG2774-RA (CG2774), mRNA 
0   NM_141608.2  CG18005-RA (CG18005), mRNA 
0   NM_001042864.1  CG9660-RE, transcript variant E (toc), mRNA 
0   NM_164524.1  CG9660-RD, transcript variant D (toc), mRNA 
0   NM_057805.2  CG9660-RA, transcript variant A (toc), mRNA 
0   NM_168692.2  CG32170-RA (CG32170), mRNA 
0   NM_132660.2  CG1716-RA (CG1716), mRNA 
0   NM_080313.2  CG9659-RC, transcript variant C (egh), mRNA 
0   NM_166946.1  CG9659-RB, transcript variant B (egh), mRNA 
0   13  NM_176557.1  CG33106-RB, transcript variant B (mask), mRNA 
0   13  NM_176556.1  CG33106-RA, transcript variant A (mask), mRNA 
0   NM_144350.1  CG7487-RA (RecQ4), mRNA 
0   NM_137959.1  CG5360-RA (CG5360), mRNA 
0   NM_139541.1  CG12017-RA (CG12017), mRNA 
0   NM_142297.2  CG14900-RA (Cad89D), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.