National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11300Ra-3 
 Symbol CG11300  Full Name CG11300 
 CG No CG11300  Old CG No CG11300 
 Synonyms BcDNA:LP08443, CG11300 
 Accession No (Link to NCBI) NM_137981.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCCTTTGGGCTTTTGGCCCTAA 
 Primer Seq. 3'
aatctagaggtaccCAATAGACGACGGTGACGGTG 
 Predicted Fragment Size
449 
 IR fragment full Seq
0001 CCTTTGGGCT TTTGGCCCTA ATAGCAACTG CCTACGCCGA TTCTCCACCT GCGGCAGGAT 
0061 CCCCACCCGC GTCATCTCCA CCGGCTGGAA CCCCAACCTC GTCACCTCCA GCGACTGGAA 
0121 CACCGCCCTC ACCATCCCCA GCGACTGGAA CACCACCTTC AGCATCCCCA GCTGCTGGTA 
0181 CACCGACCTC GCCAACTCCA GCGACTGGAA CACCGTCCTC GCCAGCTACT CCTGATGCGC 
0241 CCGCTTCCTC GACATCACCA GCTACGCCCA CATCGCCCAG TGACAGTGGA TCCAGCAGCA 
0301 GCCAGGAAGT GATTAGGCTC AGGCGTCGGC TGCGGGTGAG GCGTCANTNC CGCCGCGAGA 
0361 GGCNTCACTC CGCCGCGAGA GGCGTCAGGC CAACCAGAGT AATCAGAATG GAGGTGGTGG 
0421 TCAGGGGCGA GTGGTTCGCC GTGTACACCG TCACCGTCGT CTATTG 
 in silico PCR Fragment
0001 CCTTTGGGCT TTTGGCCCTA ATAGCAACTG CCTACGCCGA TTCTCCACCT GCGGCAGGAT 
0061 CCCCACCCGC GTCATCTCCA CCGGCTGGAA CCCCAACCTC GCCACCTCCA GCGACTGGAA 
0121 CACCGCCCTC ACCATCCCCA GCGACTGGAA CACCACCTTC AGCATCCCCA GCTGCTGGTA 
0181 CACCGACCTC GCCAACTCCA GCGACTGGAA CACCGTCCTC GCCAGCTACT CCTGATGCGC 
0241 CCGCTTCCTC GACATCACCA GCTACGCCCA CATCGCCCAG TGACAGTGGA TCCAGCAGCA 
0301 GCCAGGAAGT GATTAGGCTC AGGCGTCGGC TGCGCCGGCT GAGGCGTCAG CTCCGCCGCG 
0361 AGAGGCGTCA GGCCAACCAG AGTAATCAGA ATGGAGGTGG TGGTCAGGGG CGAGTGGTTC 
0421 GCCGTGTACA CCGTCACCGT CGTCTATTG 
 Assemble Data

11300Ra-3.IR full       1   CCTTTGGGCTTTTGGCCCTAATAGCAACTGCCTACGCCGATTCTCCACCTGCGGCAGGAT 60
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11300Ra-3.in silico     1   CCTTTGGGCTTTTGGCCCTAATAGCAACTGCCTACGCCGATTCTCCACCTGCGGCAGGAT 60


11300Ra-3.IR full       61  CCCCACCCGCGTCATCTCCACCGGCTGGAACCCCAACCTCGTCACCTCCAGCGACTGGAA 120
                            ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
11300Ra-3.in silico     61  CCCCACCCGCGTCATCTCCACCGGCTGGAACCCCAACCTCGCCACCTCCAGCGACTGGAA 120


11300Ra-3.IR full       121 CACCGCCCTCACCATCCCCAGCGACTGGAACACCACCTTCAGCATCCCCAGCTGCTGGTA 180
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11300Ra-3.in silico     121 CACCGCCCTCACCATCCCCAGCGACTGGAACACCACCTTCAGCATCCCCAGCTGCTGGTA 180


11300Ra-3.IR full       181 CACCGACCTCGCCAACTCCAGCGACTGGAACACCGTCCTCGCCAGCTACTCCTGATGCGC 240
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11300Ra-3.in silico     181 CACCGACCTCGCCAACTCCAGCGACTGGAACACCGTCCTCGCCAGCTACTCCTGATGCGC 240


11300Ra-3.IR full       241 CCGCTTCCTCGACATCACCAGCTACGCCCACATCGCCCAGTGACAGTGGATCCAGCAGCA 300
                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11300Ra-3.in silico     241 CCGCTTCCTCGACATCACCAGCTACGCCCACATCGCCCAGTGACAGTGGATCCAGCAGCA 300


11300Ra-3.IR full       301 GCCAGGAAGTGATTAGGCTCAGGCGTCGGCTGCGGGTGAGGCGTCANTNCCGCCGCGAGA 360
                            ||||||||||||||||||||||||||||||||||                  |||   ||
11300Ra-3.in silico     301 GCCAGGAAGTGATTAGGCTCAGGCGTCGGCTGCG------------------CCGGCTGA 360


11300Ra-3.IR full       361 GGCNTCA-CTCCGCCGCGAGAGGCGTCAGGCCAACCAGAGTAATCAGAATGGAGGTGGTG 420
                            ||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
11300Ra-3.in silico     361 GGCGTCAGCTCCGCCGCGAGAGGCGTCAGGCCAACCAGAGTAATCAGAATGGAGGTGGTG 420


11300Ra-3.IR full       421 GTCAGGGGCGAGTGGTTCGCCGTGTACACCGTCACCGTCGTCTATTG 467
                            |||||||||||||||||||||||||||||||||||||||||||||||
11300Ra-3.in silico     421 GTCAGGGGCGAGTGGTTCGCCGTGTACACCGTCACCGTCGTCTATTG 467

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100.92  435  38  50  114  NM_137981.1  CG11300-RA (CG11300), mRNA 
0   NM_079087.2  CG3633-RA (mRpS29), mRNA 
0   NM_165346.2  CG31673-RA (CG31673), mRNA 
0   NM_135763.2  CG5439-RA (CG5439), mRNA 
0   NM_078662.2  CG5488-RA (B-H2), mRNA 
0   NM_142215.2  CG5205-RA (CG5205), mRNA 
0   NM_134735.1  CG4785-RA (CG4785), mRNA 
0   NM_139692.1  CG4611-RA (CG4611), mRNA 
0   NM_132093.2  CG3367-RA (CG3367), mRNA 
0   NM_137392.1  CG6477-RA, transcript variant A (RhoGAP54D), mRNA 
0   NM_132773.2  CG5627-RA (rab3-GEF), mRNA 
0   NM_141003.2  CG3634-RA (CG3634), mRNA 
0   NM_132128.1  CG4547-RA (Atx-1), mRNA 
0   NM_132487.1  CG15196-RA (CG15196), mRNA 
0   NM_132134.2  CG4558-RA (CG4558), mRNA 
0   NM_169165.1  CG1104-RB, transcript variant B (CG1104), mRNA 
0   NM_141433.2  CG1104-RA, transcript variant A (CG1104), mRNA 
0   NM_134917.2  CG15406-RA (CG15406), mRNA 
0   NM_001031923.1  CG9133-RC, transcript variant C (CG9133), mRNA 
0   NM_001031921.1  CG9133-RD, transcript variant D (CG9133), mRNA 
0   NM_001031924.1  CG9130-RB, transcript variant B (CG9130), mRNA 
0   NM_001031925.1  CG9130-RA, transcript variant A (CG9130), mRNA 
0   NM_165853.1  CG13188-RA, transcript variant A (CG13188), mRNA 
0   NM_137980.2  CG12491-RA (CG12491), mRNA 
0   NM_001043102.1  CG34105-RA (CG34105), mRNA 
0   NM_131938.1  CG3568-RA (CG3568), mRNA 
0   11  NM_168119.1  CG10625-RD, transcript variant D (CG10625), mRNA 
0   11  NM_168120.1  CG10625-RB, transcript variant B (CG10625), mRNA 
0   11  NM_168121.1  CG10625-RC, transcript variant C (CG10625), mRNA 
0   11  NM_139713.2  CG10625-RA, transcript variant A (CG10625), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.