National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11290R-4 
 Symbol enok  Full Name enoki mushroom 
 CG No CG11290  Old CG No CG11290 
 Synonyms dmHAG406, anon-WO0200864.2, CG11290, rot, S1, unnamed, anon-WO0200864.1, anon-60Ba, enok 
 Accession No (Link to NCBI) NM_079114.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAAGATCAGGTCCCAGAAGCAG 
 Primer Seq. 3'
aatctagaggtaccGAATTTCCCGAGCAGTGGGTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AAGATCAGGT CCCAGAAGCA GAGGCCCTCC GTGCAGAGGA TTTGCCAGGC GATCGGCACA 
0061 CACCACAAGT TCCACGAGGA CATTGTGGCA GAGAAGCTGG AAAAAGCTGT CGAGTCGGGA 
0121 GCCGTCATAA AGGTCTACAA CAAGGGACTG CACTCCTACA AGGCACCAAT GGCCAAAGCG 
0181 TCGCGTCAAG GTGGACAAGA ACACTAATCT GTACAAATTG GTGNGCCAAG GCGGTCCACG 
0241 ACCTGGGCGA ATGCGAGGGA TCTACCATCA AGAGCATTGA GAACTACATT CAGAAGTTCA 
0301 ACTGTATCGA CTTGTCGCCC AATGTGGACT TCAAGGCGGT CATTAAGGCT TCGATCAAGA 
0361 AGGCCGTGGA TGCCGGCTTT CTGATCCAGG AGGGGAAGCT ATATAAAAAG GGCAAATCCT 
0421 TGACAACCCC ACGGAAATGC GCACCCGTCT CGGAGGTGGT CATAAAGGGC GAGGAGTCCT 
0481 GCACCCACTG CTCGGGAAAT TC 
 in silico PCR Fragment
0001 AAGATCAGGT CCCAGAAGCA GAGGCCCTCC GTGCAGAGGA TTTGCCAGGC GATCGGCACA 
0061 CACCACAAGT TCCACGAGGA CATTGTGGCA GAGAAGCTGG AAAAAGCTGT CGAGTCGGGA 
0121 GCCGTCATAA AGGTCTACAA CAAGGGACTG CACTCCTACA AGGCACCAAT GGCC-AAGCG 
0181 TCGCGTCAAG GTGGACAAGA ACACTAATCT GTACAAATTG GTG-GCCAAG GCGGTCCACG 
0241 ACCTGGGCGA ATGCGAGGGA TCTACCATCA AGAGCATTGA GAACTACATT CAGAAGTTCA 
0301 ACTGTATCGA CTTGTCGCCC AATGTGGACT TCAAGGCGGT CATTAAGGCT TCGATCAAGA 
0361 AGGCCGTGGA TGCCGGCTTT CTGATCCAGG AGGGGAAGCT ATATAAAAAG GGCAAATCCT 
0421 TGACAACCCC ACGGAAATGC GCACCCGTCT CGGAGGTGGT CATAAAGGGC GAGGAGTCCT 
0481 GCACCCACTG CTCGGGAAAT TC 
 Assemble Data

11290R-4.IR_full       1   AAGATCAGGTCCCAGAAGCAGAGGCCCTCCGTGCAGAGGATTTGCCAGGCGATCGGCACA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11290R-4.in silico     1   AAGATCAGGTCCCAGAAGCAGAGGCCCTCCGTGCAGAGGATTTGCCAGGCGATCGGCACA 60


11290R-4.IR_full       61  CACCACAAGTTCCACGAGGACATTGTGGCAGAGAAGCTGGAAAAAGCTGTCGAGTCGGGA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11290R-4.in silico     61  CACCACAAGTTCCACGAGGACATTGTGGCAGAGAAGCTGGAAAAAGCTGTCGAGTCGGGA 120


11290R-4.IR_full       121 GCCGTCATAAAGGTCTACAACAAGGGACTGCACTCCTACAAGGCACCAATGGCCAAAGCG 180
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
11290R-4.in silico     121 GCCGTCATAAAGGTCTACAACAAGGGACTGCACTCCTACAAGGCACCAATGGCC-AAGCG 180


11290R-4.IR_full       181 TCGCGTCAAGGTGGACAAGAACACTAATCTGTACAAATTGGTGNGCCAAGGCGGTCCACG 240
                           ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
11290R-4.in silico     181 TCGCGTCAAGGTGGACAAGAACACTAATCTGTACAAATTGGTG-GCCAAGGCGGTCCACG 240


11290R-4.IR_full       241 ACCTGGGCGAATGCGAGGGATCTACCATCAAGAGCATTGAGAACTACATTCAGAAGTTCA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11290R-4.in silico     241 ACCTGGGCGAATGCGAGGGATCTACCATCAAGAGCATTGAGAACTACATTCAGAAGTTCA 300


11290R-4.IR_full       301 ACTGTATCGACTTGTCGCCCAATGTGGACTTCAAGGCGGTCATTAAGGCTTCGATCAAGA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11290R-4.in silico     301 ACTGTATCGACTTGTCGCCCAATGTGGACTTCAAGGCGGTCATTAAGGCTTCGATCAAGA 360


11290R-4.IR_full       361 AGGCCGTGGATGCCGGCTTTCTGATCCAGGAGGGGAAGCTATATAAAAAGGGCAAATCCT 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11290R-4.in silico     361 AGGCCGTGGATGCCGGCTTTCTGATCCAGGAGGGGAAGCTATATAAAAAGGGCAAATCCT 420


11290R-4.IR_full       421 TGACAACCCCACGGAAATGCGCACCCGTCTCGGAGGTGGTCATAAAGGGCGAGGAGTCCT 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11290R-4.in silico     421 TGACAACCCCACGGAAATGCGCACCCGTCTCGGAGGTGGTCATAAAGGGCGAGGAGTCCT 480


11290R-4.IR_full       481 GCACCCACTGCTCGGGAAATTC 502
                           ||||||||||||||||||||||
11290R-4.in silico     481 GCACCCACTGCTCGGGAAATTC 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079114.1  CG11290-RA (enok), mRNA 
0.2   NM_140521.1  CG6498-RA (CG6498), mRNA 
0   NM_080091.2  CG14993-RA (Faa), mRNA 
0   NM_132148.1  CG3032-RA (CG3032), mRNA 
0   NM_079571.1  CG8374-RA (dmt), mRNA 
0   NR_001305.1  CG8374-RA (dmt), mRNA, mRNA 
0   NM_080317.2  CG2647-RA (per), mRNA 
0   NM_164399.1  CG4226-RB, transcript variant B (GluRIIC), mRNA 
0   NM_134713.2  CG4226-RA, transcript variant A (GluRIIC), mRNA 
0   16  NM_141666.2  CG9492-RA (CG9492), mRNA 
0   NM_136257.2  CG8677-RA (CG8677), mRNA 
0   NM_136155.2  CG10628-RA (CG10628), mRNA 
0   NM_166099.1  CG8182-RB, transcript variant B (GalNAc-T1), mRNA 
0   NM_137199.2  CG8182-RA, transcript variant A (GalNAc-T1), mRNA 
0   NM_169061.1  CG8182-RA, transcript variant A (GalNAc-T1), mRNA,4,5,-tris-phosphate receptor CG1063-RA, transcript variant A (Itp-r83A), mRNA 
0   NM_169060.1  CG8182-RA, transcript variant A (GalNAc-T1), mRNA,4,5,-tris-phosphate receptor CG1063-RA, transcript variant A (Itp-r83A), mRNA,4,5,-tris-phosphate receptor CG1063-RB, transcript variant B (Itp-r83A), mRNA 
0   NM_136851.1  CG13196-RA (CG13196), mRNA 
0   NM_134690.2  CG2807-RA (CG2807), mRNA 
0   NM_133022.1  CG6762-RA (CG6762), mRNA 
0   NM_057678.3  CG31240-RA (repo), mRNA 
0   NM_138193.1  CG17180-RA (CG17180), mRNA 
0   NM_135762.2  CG16975-RB, transcript variant B (CG16975), mRNA 
0   NM_135840.2  CG7968-RA (CG7968), mRNA 
0   NM_141313.1  CG2182-RA, transcript variant A (CG2182), mRNA 
0   NM_140067.1  CG3654-RD (CG3654), mRNA 
0   NM_165184.1  CG17927-RJ, transcript variant J (Mhc), mRNA 
0   NM_165183.1  CG17927-RE, transcript variant E (Mhc), mRNA 
0   NM_165182.1  CG17927-RG, transcript variant G (Mhc), mRNA 
0   NM_165181.1  CG17927-RC, transcript variant C (Mhc), mRNA 
0   NM_170089.1  CG10367-RA, transcript variant A (Hmgcr), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
+- 
DB
+- 
DC
DM
 
VM
 
VB
 
Caspase-3 signal
N
DB
DC
++ 
DM
 
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.