National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11290R-1 
 Symbol enok  Full Name enoki mushroom 
 CG No CG11290  Old CG No CG11290 
 Synonyms dmHAG406, anon-WO0200864.2, CG11290, rot, S1, unnamed, anon-WO0200864.1, anon-60Ba, enok 
 Accession No (Link to NCBI) NM_079114.1 
 Inserted Chr. ll 
 Insertional Mutation  semi-lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Molnar C, Casado M, López-Varea A, Cruz C, de Celis JF.
Genetic annotation of gain-of-function screens using RNA interference and in situ hybridization of candidate genes in the Drosophila wing.
Genetics (2012) 192(2) 741-52 [ PubMed ID = 22798488 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   AAGATCAGGTCCCAGAAGCAGAGGCCCTCCGTGCAGAGGATTTGCCAGGCGATCGGCACA 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CACCACAAGTTCCACGAGGACATTGTGGCAGAGAAGCTGGAAAAAGCTGTCGAGTCGGGA 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| silico     121 GCCGTCATAAAGGTCTACAACAAGGGACTGCACTCCTACAAGGCACCAATGGCC-AAGCG 180

                           ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| silico     181 TCGCGTCAAGGTGGACAAGAACACTAATCTGTACAAATTGGTG-GCCAAGGCGGTCCACG 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 ACCTGGGCGAATGCGAGGGATCTACCATCAAGAGCATTGAGAACTACATTCAGAAGTTCA 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 ACTGTATCGACTTGTCGCCCAATGTGGACTTCAAGGCGGTCATTAAGGCTTCGATCAAGA 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 AGGCCGTGGATGCCGGCTTTCTGATCCAGGAGGGGAAGCTATATAAAAAGGGCAAATCCT 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TGACAACCCCACGGAAATGCGCACCCGTCTCGGAGGTGGTCATAAAGGGCGAGGAGTCCT 480

11290R-1.IR_full       481 GCACCCACTGCTCGGGAAATTC 502
                           |||||||||||||||||||||| silico     481 GCACCCACTGCTCGGGAAATTC 502

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079114.1  CG11290-RA (enok), mRNA 
0.2   NM_140521.1  CG6498-RA (CG6498), mRNA 
0   NM_080091.2  CG14993-RA (Faa), mRNA 
0   NM_132148.1  CG3032-RA (CG3032), mRNA 
0   NM_079571.1  CG8374-RA (dmt), mRNA 
0   NR_001305.1  CG8374-RA (dmt), mRNA, mRNA 
0   NM_080317.2  CG2647-RA (per), mRNA 
0   NM_164399.1  CG4226-RB, transcript variant B (GluRIIC), mRNA 
0   NM_134713.2  CG4226-RA, transcript variant A (GluRIIC), mRNA 
0   16  NM_141666.2  CG9492-RA (CG9492), mRNA 
0   NM_136257.2  CG8677-RA (CG8677), mRNA 
0   NM_136155.2  CG10628-RA (CG10628), mRNA 
0   NM_166099.1  CG8182-RB, transcript variant B (GalNAc-T1), mRNA 
0   NM_137199.2  CG8182-RA, transcript variant A (GalNAc-T1), mRNA 
0   NM_169061.1  CG8182-RA, transcript variant A (GalNAc-T1), mRNA,4,5,-tris-phosphate receptor CG1063-RA, transcript variant A (Itp-r83A), mRNA 
0   NM_169060.1  CG8182-RA, transcript variant A (GalNAc-T1), mRNA,4,5,-tris-phosphate receptor CG1063-RA, transcript variant A (Itp-r83A), mRNA,4,5,-tris-phosphate receptor CG1063-RB, transcript variant B (Itp-r83A), mRNA 
0   NM_136851.1  CG13196-RA (CG13196), mRNA 
0   NM_134690.2  CG2807-RA (CG2807), mRNA 
0   NM_133022.1  CG6762-RA (CG6762), mRNA 
0   NM_057678.3  CG31240-RA (repo), mRNA 
0   NM_138193.1  CG17180-RA (CG17180), mRNA 
0   NM_135762.2  CG16975-RB, transcript variant B (CG16975), mRNA 
0   NM_135840.2  CG7968-RA (CG7968), mRNA 
0   NM_141313.1  CG2182-RA, transcript variant A (CG2182), mRNA 
0   NM_140067.1  CG3654-RD (CG3654), mRNA 
0   NM_165184.1  CG17927-RJ, transcript variant J (Mhc), mRNA 
0   NM_165183.1  CG17927-RE, transcript variant E (Mhc), mRNA 
0   NM_165182.1  CG17927-RG, transcript variant G (Mhc), mRNA 
0   NM_165181.1  CG17927-RC, transcript variant C (Mhc), mRNA 
0   NM_170089.1  CG10367-RA, transcript variant A (Hmgcr), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.