National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11251R-3 
 Symbol CG11251  Full Name CG11251 
 CG No CG11251  Old CG No CG11251 
 Synonyms CG11251 
 Accession No (Link to NCBI) NM_140375.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ACCTCCTTCGCAACTTCATTCCCAAGTGGTGTCTCCCACGTCCAGAGAAGCATCTCCAGA 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  ACCACATATTCCGTCAGCTCCAGACGAATCACCCATCCGCCGCACTGGTGGCCATCAAAA 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CAAGTGAACAGGTGCTGCCCAAGTGCAGATTCATGCAGTACCGGCGCGCCAATGAGCAGG 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| silico     181 TGAAGCGATTGGGCATGGTCTCCGAGGATGGCAGCAAGATGGCGGAGCTA-TCGAGCATG 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 ACCTGCGCCGCCCCCAATATGATGGACTTCATCCAGCAGAGATACTGCATGGTTAGCCTG 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CTGGACAGTGTGCAATTCATGAAGATCGAGGATGTGGAGGCCGTGGATCTCCGCCTGCTG 360

                           |||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||| silico     361 CCACCCATCGATTCCCCCAGTAAGATCATTGGCGTGGACTGCAACTATGTGGATAACTGT 420

                           ||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||| silico     421 GATGAGCAGCACATCTCGATTCCGAGGGAGCCGAGTTTTCACGTCAAGTTCGCCTCCTCG 480

11251R-3.IR_full       481 ATAACCGGAGCTCTGGACAAC 501
                           ||||||||||||||||||||| silico     481 ATAACCGGAGCTCTGGACAAC 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140375.1  CG11251-RA (CG11251), mRNA 
0   NM_132004.2  CG4136-RA (CG4136), mRNA 
0   NM_137803.1  CG6758-RA (CG6758), mRNA 
0   NM_132300.2  CG12664-RB (ld14), mRNA 
0   NM_168843.1  CG32225-RA (CG32225), mRNA 
0   NM_135485.4  CG4619-RA (CG4619), mRNA 
0   NM_165090.1  CG31835-RA (CG31835), mRNA 
0   NM_001043247.1  CG6535-RB (tefu), mRNA 
0   NM_137578.2  CG7744-RA (CG7744), mRNA 
0   NM_141026.1  CG10566-RA (CG10566), mRNA 
0   NM_137925.2  CG3162-RA (CG3162), mRNA 
0   NM_135643.2  CG6192-RA (CG6192), mRNA 
0   NM_134512.4  CG12701-RA, transcript variant A (CG12701), mRNA 
0   NM_167685.1  CG12701-RB, transcript variant B (CG12701), mRNA 
0   NM_136788.1  CG12944-RA, transcript variant A (Obp47a), mRNA 
0   NM_206088.1  CG12944-RB, transcript variant B (Obp47a), mRNA 
0   NM_136224.2  CG14400-RA (CG14400), mRNA 
0   NM_170513.1  CG31021-RA (CG31021), mRNA 
0   18  NM_132335.2  CG12139-RB (CG12139), mRNA 
0   NM_166290.1  CG30120-RA (CG30120), mRNA 
0   16  NM_057368.3  CG2621-RD, transcript variant D (sgg), mRNA 
0   NM_001031910.1  CG11566-RA (CG11566), mRNA 
0   NM_001031911.1  CG33670-RA (CG33670), mRNA 
0   NM_168844.1  CG6680-RB, transcript variant B (CG6680), mRNA 
0   NM_140948.2  CG6680-RA, transcript variant A (CG6680), mRNA 
0   NM_168232.2  CG32369-RA, transcript variant A (CG32369), mRNA 
0   NM_139899.3  CG32369-RB, transcript variant B (CG32369), mRNA 
0   10  NM_136158.2  CG10538-RA (CdGAPr), mRNA 
0   NM_057420.3  CG7875-RA (trp), mRNA 
0   NM_170512.1  CG31019-RA (CG31019), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.