National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11251R-1 
 Symbol CG11251  Full Name CG11251 
 CG No CG11251  Old CG No CG11251 
 Synonyms CG11251 
 Accession No (Link to NCBI) NM_140375.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACCTCCTTCGCAACTTCATTC 
 Primer Seq. 3'
aatctagaggtaccGTTGTCCAGAGCTCCGGTTAT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ACCTCCTTCG CAACTTCATT CCCAAGTGGT GTCTCCCACG TCCAGAGAAG CATCTCCAGA 
0061 ACCACATATT CCGTCAGCTC CAGACGAATC ACCCATCCGC CGCACTGGTG GCCATCAAAA 
0121 CAAGTGAACA GGTGCTGCCC AAGTGCAGAT TCATGCAGTA CCGGCGCGCC AATGAGCAGG 
0181 TGAAGCGATT GGGCATGGTC TCCGAGGATG GCAGCAAGAT GGCGGAGCTA NTCGAGCATG 
0241 ACCTGCGCCG CCCCCAATAT GATGGACTTC ATCCAGCAGA GATACTGCAT GGTTAGCCTG 
0301 CTGGACAGTG TGCAATTCAT GAAGATCGAG GATGTGGAGG CCGTGGATCT CCGCCTGCTG 
0361 CCACCCATCG ATTCCCCCGG TAAGATCATT GGCGTGGACT GCAACTATGT GGACAACTGT 
0421 GATGAGCAGC ACATCTCCAT TCCGAGGGAG CCGAGCTTTC ACGTCAAGTT CGCCTCCTCG 
0481 ATAACCGGAG CTCTGGACAA C 
 in silico PCR Fragment
0001 ACCTCCTTCG CAACTTCATT CCCAAGTGGT GTCTCCCACG TCCAGAGAAG CATCTCCAGA 
0061 ACCACATATT CCGTCAGCTC CAGACGAATC ACCCATCCGC CGCACTGGTG GCCATCAAAA 
0121 CAAGTGAACA GGTGCTGCCC AAGTGCAGAT TCATGCAGTA CCGGCGCGCC AATGAGCAGG 
0181 TGAAGCGATT GGGCATGGTC TCCGAGGATG GCAGCAAGAT GGCGGAGCTA -TCGAGCATG 
0241 ACCTGCGCCG CCCCCAATAT GATGGACTTC ATCCAGCAGA GATACTGCAT GGTTAGCCTG 
0301 CTGGACAGTG TGCAATTCAT GAAGATCGAG GATGTGGAGG CCGTGGATCT CCGCCTGCTG 
0361 CCACCCATCG ATTCCCCCAG TAAGATCATT GGCGTGGACT GCAACTATGT GGATAACTGT 
0421 GATGAGCAGC ACATCTCGAT TCCGAGGGAG CCGAGTTTTC ACGTCAAGTT CGCCTCCTCG 
0481 ATAACCGGAG CTCTGGACAA C 
 Assemble Data

11251R-1.IR_full       1   ACCTCCTTCGCAACTTCATTCCCAAGTGGTGTCTCCCACGTCCAGAGAAGCATCTCCAGA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11251R-1.in silico     1   ACCTCCTTCGCAACTTCATTCCCAAGTGGTGTCTCCCACGTCCAGAGAAGCATCTCCAGA 60


11251R-1.IR_full       61  ACCACATATTCCGTCAGCTCCAGACGAATCACCCATCCGCCGCACTGGTGGCCATCAAAA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11251R-1.in silico     61  ACCACATATTCCGTCAGCTCCAGACGAATCACCCATCCGCCGCACTGGTGGCCATCAAAA 120


11251R-1.IR_full       121 CAAGTGAACAGGTGCTGCCCAAGTGCAGATTCATGCAGTACCGGCGCGCCAATGAGCAGG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11251R-1.in silico     121 CAAGTGAACAGGTGCTGCCCAAGTGCAGATTCATGCAGTACCGGCGCGCCAATGAGCAGG 180


11251R-1.IR_full       181 TGAAGCGATTGGGCATGGTCTCCGAGGATGGCAGCAAGATGGCGGAGCTANTCGAGCATG 240
                           |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
11251R-1.in silico     181 TGAAGCGATTGGGCATGGTCTCCGAGGATGGCAGCAAGATGGCGGAGCTA-TCGAGCATG 240


11251R-1.IR_full       241 ACCTGCGCCGCCCCCAATATGATGGACTTCATCCAGCAGAGATACTGCATGGTTAGCCTG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11251R-1.in silico     241 ACCTGCGCCGCCCCCAATATGATGGACTTCATCCAGCAGAGATACTGCATGGTTAGCCTG 300


11251R-1.IR_full       301 CTGGACAGTGTGCAATTCATGAAGATCGAGGATGTGGAGGCCGTGGATCTCCGCCTGCTG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11251R-1.in silico     301 CTGGACAGTGTGCAATTCATGAAGATCGAGGATGTGGAGGCCGTGGATCTCCGCCTGCTG 360


11251R-1.IR_full       361 CCACCCATCGATTCCCCCGGTAAGATCATTGGCGTGGACTGCAACTATGTGGACAACTGT 420
                           |||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||
11251R-1.in silico     361 CCACCCATCGATTCCCCCAGTAAGATCATTGGCGTGGACTGCAACTATGTGGATAACTGT 420


11251R-1.IR_full       421 GATGAGCAGCACATCTCCATTCCGAGGGAGCCGAGCTTTCACGTCAAGTTCGCCTCCTCG 480
                           ||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||
11251R-1.in silico     421 GATGAGCAGCACATCTCGATTCCGAGGGAGCCGAGTTTTCACGTCAAGTTCGCCTCCTCG 480


11251R-1.IR_full       481 ATAACCGGAGCTCTGGACAAC 501
                           |||||||||||||||||||||
11251R-1.in silico     481 ATAACCGGAGCTCTGGACAAC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140375.1  CG11251-RA (CG11251), mRNA 
0   NM_132004.2  CG4136-RA (CG4136), mRNA 
0   NM_137803.1  CG6758-RA (CG6758), mRNA 
0   NM_132300.2  CG12664-RB (ld14), mRNA 
0   NM_168843.1  CG32225-RA (CG32225), mRNA 
0   NM_135485.4  CG4619-RA (CG4619), mRNA 
0   NM_165090.1  CG31835-RA (CG31835), mRNA 
0   NM_001043247.1  CG6535-RB (tefu), mRNA 
0   NM_137578.2  CG7744-RA (CG7744), mRNA 
0   NM_141026.1  CG10566-RA (CG10566), mRNA 
0   NM_137925.2  CG3162-RA (CG3162), mRNA 
0   NM_135643.2  CG6192-RA (CG6192), mRNA 
0   NM_134512.4  CG12701-RA, transcript variant A (CG12701), mRNA 
0   NM_167685.1  CG12701-RB, transcript variant B (CG12701), mRNA 
0   NM_136788.1  CG12944-RA, transcript variant A (Obp47a), mRNA 
0   NM_206088.1  CG12944-RB, transcript variant B (Obp47a), mRNA 
0   NM_136224.2  CG14400-RA (CG14400), mRNA 
0   NM_170513.1  CG31021-RA (CG31021), mRNA 
0   18  NM_132335.2  CG12139-RB (CG12139), mRNA 
0   NM_166290.1  CG30120-RA (CG30120), mRNA 
0   16  NM_057368.3  CG2621-RD, transcript variant D (sgg), mRNA 
0   NM_001031910.1  CG11566-RA (CG11566), mRNA 
0   NM_001031911.1  CG33670-RA (CG33670), mRNA 
0   NM_168844.1  CG6680-RB, transcript variant B (CG6680), mRNA 
0   NM_140948.2  CG6680-RA, transcript variant A (CG6680), mRNA 
0   NM_168232.2  CG32369-RA, transcript variant A (CG32369), mRNA 
0   NM_139899.3  CG32369-RB, transcript variant B (CG32369), mRNA 
0   10  NM_136158.2  CG10538-RA (CdGAPr), mRNA 
0   NM_057420.3  CG7875-RA (trp), mRNA 
0   NM_170512.1  CG31019-RA (CG31019), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.