National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11249R-3 
 Symbol CG11249  Full Name CG11249 
 CG No CG11249  Old CG No CG11249 
 Synonyms CG11249 
 Accession No (Link to NCBI) NM_141089.1 
 Inserted Chr.
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ATGAGGATGGTGAGGAGCGGAAGGCATCGACCTTCGAGTCGATTATAGACAACATGTTCA 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GCCGGTTGCGGATCATCGCAGTGGACGTGGAGAAATTACAGAAGGCCAAGGAGAAGTTAA 120

                           ||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||| silico     121 ATATTATGCAACGGC-GGAACACCTTCTACCATCTTCTAGGCCAAGAGGAAGAAGTCAGC 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 ATGAACCGTGGAAGCGAGATGGCGATTCTTCGATCCAAGTATTCCTTACATTCGGGTTTC 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 AATCAGAATTGCAGCTCGGCCTCGGAGGAGGAACTCGACTTCGAGGAGTTAAGCGAGGAT 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CCGTGCAACATATCTTTCGAGGAGGATCGCTGGCACGGTTTCTTCAAAGACTTTCAGATC 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CTGACCACCCCAGTCGGCACCGATCCCAACGAGAACCGCAAGTGTGTGGAACTGACTTCG 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 ATGACGAACTGCGATCTCGAGATCAAACACCATCTATTGGGCGGAGTCCGCTGCTTTATG 480

11249R-3.IR_full       481 GTCAACCTTTTCGAGGGCACT 501
                           ||||||||||||||||||||| silico     481 GTCAACCTTTTCGAGGGCACT 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_141089.1  CG11249-RA (CG11249), mRNA 
0.2   NM_166034.1  CG8367-RB, transcript variant B (cg), mRNA 
0.2   NM_079014.2  CG8367-RD, transcript variant D (cg), mRNA 
0.2   NM_166036.1  CG8367-RC, transcript variant C (cg), mRNA 
0.2   NM_166035.1  CG8367-RA, transcript variant A (cg), mRNA 
0.2   NM_169594.2  CG3389-RA (Cad88C), mRNA 
0   NM_132395.1  CG2898-RA (CG2898), mRNA 
0   NM_141363.1  CG15589-RA (CG15589), mRNA 
0   NM_137251.2  CG8443-RA (CG8443), mRNA 
0   NM_132375.1  CG2972-RA (CG2972), mRNA 
0   NM_164561.2  CG3920-RB, transcript variant B (l(2)k16918), mRNA 
0   NM_134656.2  CG3709-RA (CG3709), mRNA 
0   NM_134576.2  CG1532-RA (CG1532), mRNA 
0   NM_080019.2  CG9943-RA (Surf1), mRNA 
0   NM_080044.2  CG13906-RA (nerfin-1), mRNA 
0   NM_205996.1  CG33310-RA (CG33310), mRNA 
0   NM_079949.2  CG7586-RA (Mcr), mRNA 
0   NM_135228.1  CG11321-RA, transcript variant A (CG11321), mRNA 
0   NM_164709.1  CG11321-RB, transcript variant B (CG11321), mRNA 
0   NM_136854.1  CG13194-RA (pyr), mRNA 
0   NM_164598.1  CG2950-RA, transcript variant A (CG2950), mRNA 
0   NM_135022.1  CG2950-RB, transcript variant B (CG2950), mRNA 
0   NM_164599.1  CG2950-RC, transcript variant C (CG2950), mRNA 
0   NM_167523.2  CG9819-RA, transcript variant A (CanA-14F), mRNA 
0   NM_167524.2  CG9819-RB, transcript variant B (CanA-14F), mRNA 
0   NM_169996.1  CG5740-RA, transcript variant A (CG5740), mRNA 
0   NM_142753.2  CG5740-RB, transcript variant B (CG5740), mRNA 
0   NM_176339.1  CG9674-RD, transcript variant D (CG9674), mRNA 
0   NM_140665.1  CG9674-RA, transcript variant A (CG9674), mRNA 
0   NM_168687.1  CG9674-RC, transcript variant C (CG9674), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.