National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11249R-2 
 Symbol CG11249  Full Name CG11249 
 CG No CG11249  Old CG No CG11249 
 Synonyms CG11249 
 Accession No (Link to NCBI) NM_141089.1 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGAGGATGGTGAGGAGCGGA 
 Primer Seq. 3'
aatctagaggtaccAGTGCCCTCGAAAAGGTTGAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGAGGATGG TGAGGAGCGG AAGGCATCGA CCTTCGAGTC GATTATAGAC AACATGTTCA 
0061 GCCGGTTGCG GATCATCGCA GTGGACGTGG AGAAATTACA GAAGGCCAAG GAGAAGTTAA 
0121 ATATTATGCA ACGGCNGGAA CACCTTCTAC CATCTTCTAG GCCAGGAGGA AGAAGTCAGC 
0181 ATGAACCGTG GAAGCGAGAT GGCGATTCTT CGATCCAAGT ATTCCTTACA TTCGGGTTTC 
0241 AATCAGAATT GCAGCTCGGC CTCGGAGGAG GAACTCGACT TCGAGGAGTT AAGCGAGGAT 
0301 CCGTGCAACA TATCTTTCGA GGAGGATCGC TGGCACGGTT TCTTCAAAGA CTTTCAGATC 
0361 CTGACCACCC CAGTCGGCAC CGATCCCAAC GAGAACCGCA AGTGTGTGGA ACTGACTTCG 
0421 ATGACGAACT GCGATCTCGA GATCAAACAC CATCTATTGG GCGGAGTCCG CTGCTTTATG 
0481 GTCAACCTTT TCGAGGGCAC T 
 in silico PCR Fragment
0001 ATGAGGATGG TGAGGAGCGG AAGGCATCGA CCTTCGAGTC GATTATAGAC AACATGTTCA 
0061 GCCGGTTGCG GATCATCGCA GTGGACGTGG AGAAATTACA GAAGGCCAAG GAGAAGTTAA 
0121 ATATTATGCA ACGGC-GGAA CACCTTCTAC CATCTTCTAG GCCAAGAGGA AGAAGTCAGC 
0181 ATGAACCGTG GAAGCGAGAT GGCGATTCTT CGATCCAAGT ATTCCTTACA TTCGGGTTTC 
0241 AATCAGAATT GCAGCTCGGC CTCGGAGGAG GAACTCGACT TCGAGGAGTT AAGCGAGGAT 
0301 CCGTGCAACA TATCTTTCGA GGAGGATCGC TGGCACGGTT TCTTCAAAGA CTTTCAGATC 
0361 CTGACCACCC CAGTCGGCAC CGATCCCAAC GAGAACCGCA AGTGTGTGGA ACTGACTTCG 
0421 ATGACGAACT GCGATCTCGA GATCAAACAC CATCTATTGG GCGGAGTCCG CTGCTTTATG 
0481 GTCAACCTTT TCGAGGGCAC T 
 Assemble Data

11249R-2.IR_full       1   ATGAGGATGGTGAGGAGCGGAAGGCATCGACCTTCGAGTCGATTATAGACAACATGTTCA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11249R-2.in silico     1   ATGAGGATGGTGAGGAGCGGAAGGCATCGACCTTCGAGTCGATTATAGACAACATGTTCA 60


11249R-2.IR_full       61  GCCGGTTGCGGATCATCGCAGTGGACGTGGAGAAATTACAGAAGGCCAAGGAGAAGTTAA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11249R-2.in silico     61  GCCGGTTGCGGATCATCGCAGTGGACGTGGAGAAATTACAGAAGGCCAAGGAGAAGTTAA 120


11249R-2.IR_full       121 ATATTATGCAACGGCNGGAACACCTTCTACCATCTTCTAGGCCAGGAGGAAGAAGTCAGC 180
                           ||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||
11249R-2.in silico     121 ATATTATGCAACGGC-GGAACACCTTCTACCATCTTCTAGGCCAAGAGGAAGAAGTCAGC 180


11249R-2.IR_full       181 ATGAACCGTGGAAGCGAGATGGCGATTCTTCGATCCAAGTATTCCTTACATTCGGGTTTC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11249R-2.in silico     181 ATGAACCGTGGAAGCGAGATGGCGATTCTTCGATCCAAGTATTCCTTACATTCGGGTTTC 240


11249R-2.IR_full       241 AATCAGAATTGCAGCTCGGCCTCGGAGGAGGAACTCGACTTCGAGGAGTTAAGCGAGGAT 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11249R-2.in silico     241 AATCAGAATTGCAGCTCGGCCTCGGAGGAGGAACTCGACTTCGAGGAGTTAAGCGAGGAT 300


11249R-2.IR_full       301 CCGTGCAACATATCTTTCGAGGAGGATCGCTGGCACGGTTTCTTCAAAGACTTTCAGATC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11249R-2.in silico     301 CCGTGCAACATATCTTTCGAGGAGGATCGCTGGCACGGTTTCTTCAAAGACTTTCAGATC 360


11249R-2.IR_full       361 CTGACCACCCCAGTCGGCACCGATCCCAACGAGAACCGCAAGTGTGTGGAACTGACTTCG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11249R-2.in silico     361 CTGACCACCCCAGTCGGCACCGATCCCAACGAGAACCGCAAGTGTGTGGAACTGACTTCG 420


11249R-2.IR_full       421 ATGACGAACTGCGATCTCGAGATCAAACACCATCTATTGGGCGGAGTCCGCTGCTTTATG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11249R-2.in silico     421 ATGACGAACTGCGATCTCGAGATCAAACACCATCTATTGGGCGGAGTCCGCTGCTTTATG 480


11249R-2.IR_full       481 GTCAACCTTTTCGAGGGCACT 501
                           |||||||||||||||||||||
11249R-2.in silico     481 GTCAACCTTTTCGAGGGCACT 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_141089.1  CG11249-RA (CG11249), mRNA 
0.2   NM_166034.1  CG8367-RB, transcript variant B (cg), mRNA 
0.2   NM_079014.2  CG8367-RD, transcript variant D (cg), mRNA 
0.2   NM_166036.1  CG8367-RC, transcript variant C (cg), mRNA 
0.2   NM_166035.1  CG8367-RA, transcript variant A (cg), mRNA 
0.2   NM_169594.2  CG3389-RA (Cad88C), mRNA 
0   NM_132395.1  CG2898-RA (CG2898), mRNA 
0   NM_141363.1  CG15589-RA (CG15589), mRNA 
0   NM_137251.2  CG8443-RA (CG8443), mRNA 
0   NM_132375.1  CG2972-RA (CG2972), mRNA 
0   NM_164561.2  CG3920-RB, transcript variant B (l(2)k16918), mRNA 
0   NM_134656.2  CG3709-RA (CG3709), mRNA 
0   NM_134576.2  CG1532-RA (CG1532), mRNA 
0   NM_080019.2  CG9943-RA (Surf1), mRNA 
0   NM_080044.2  CG13906-RA (nerfin-1), mRNA 
0   NM_205996.1  CG33310-RA (CG33310), mRNA 
0   NM_079949.2  CG7586-RA (Mcr), mRNA 
0   NM_135228.1  CG11321-RA, transcript variant A (CG11321), mRNA 
0   NM_164709.1  CG11321-RB, transcript variant B (CG11321), mRNA 
0   NM_136854.1  CG13194-RA (pyr), mRNA 
0   NM_164598.1  CG2950-RA, transcript variant A (CG2950), mRNA 
0   NM_135022.1  CG2950-RB, transcript variant B (CG2950), mRNA 
0   NM_164599.1  CG2950-RC, transcript variant C (CG2950), mRNA 
0   NM_167523.2  CG9819-RA, transcript variant A (CanA-14F), mRNA 
0   NM_167524.2  CG9819-RB, transcript variant B (CanA-14F), mRNA 
0   NM_169996.1  CG5740-RA, transcript variant A (CG5740), mRNA 
0   NM_142753.2  CG5740-RB, transcript variant B (CG5740), mRNA 
0   NM_176339.1  CG9674-RD, transcript variant D (CG9674), mRNA 
0   NM_140665.1  CG9674-RA, transcript variant A (CG9674), mRNA 
0   NM_168687.1  CG9674-RC, transcript variant C (CG9674), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.