National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11246R-3 
 Symbol Rpb8  Full Name Rpb8 
 CG No CG11246  Old CG No CG11246 
 Synonyms RPB8, CG11246, Rpb8 
 Accession No (Link to NCBI) NM_141095.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
Ohhara Y, Nakamura A, Kato Y, Yamakawa-Kobayashi K.
Chaperonin TRiC/CCT supports mitotic exit and entry into endocycle in Drosophila.
PLoS Genet. (2019) 15(4) e1008121 [ PubMed ID = 31034473 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment balanced with SM6a, Cy 
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGCTGGAGTACTCTTTGAGGA 
 Primer Seq. 3'
aatctagaggtaccGCCGCTTCATCAGCAGGTACA 
 Predicted Fragment Size
437 
 IR fragment full Seq
0001 GGCTGGAGTA CTCTTTGAGG ACATCTTCAA CGTAAAGGAC ATGGATCCGG AGGGCAAAAA 
0061 GTTCGACCGT GTATCCCGCC TGCACTGCGA GTCCGAGTCG TTTAAGATGG ACCTCATCCT 
0121 GGACATCAAC TCGTGGCTAT ACCCCATGGA GCTGGGCGAC AAGTTCCGCC TGGTTTTGGC 
0181 CACCACCCTG CGCGAGGATG GTTGCCCGGA CAGCGGGGAG TACAATCCAA TGGAGCACGA 
0241 GGGAACGCGG GCGGACAGCT TTGAGTACGT GATGTACGGC AAGATCTACA GGATCGAGGG 
0301 CGACGAAGCA CACAATGAGG CCTCCCGGCT CTCCGCCTAC GTGTCATTCG GCGGCTTGCT 
0361 GATGCGACTT CAGGGTGACG CCAACAATCT TCATGGCTTC GAGGTGGACC AGCACATGTA 
0421 CCTGCTGATG AAGCGGC 
 in silico PCR Fragment
0001 GGCTGGAGTA CTCTTTGAGG ACATCTTCAA CGTAAAGGAC ATGGATCCGG AGGGCAAAAA 
0061 GTTCGACCGT GTATCCCGCC TGCACTGCGA GTCCGAGTCG TTTAAGATGG ACCTCATCCT 
0121 GGACATCAAC TCGTGGCTAT ACCCCATGGA GCTGGGCGAC AAGTTCCGCC TGGTTTTGGC 
0181 CACCACCCTG CGCGAGGATG GTTGCCCGGA CAGCGGGGAG TACAATCCAA TGGAGCACGA 
0241 GGGAACGCGG GCGGACAGCT TTGAGTACGT GATGTACGGC AAGATCTACA GGATCGAGGG 
0301 CGACGAAGCA CACAATGAGG CCTCCCGGCT CTCCGCCTAC GTGTCATTCG GCGGCTTGCT 
0361 GATGCGACTT CAGGGTGACG CCAACAATCT TCATGGCTTC GAGGTGGACC AGCACATGTA 
0421 CCTGCTGATG AAGCGGC 
 Assemble Data

11246R-3.IR_full       1   GGCTGGAGTACTCTTTGAGGACATCTTCAACGTAAAGGACATGGATCCGGAGGGCAAAAA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11246R-3.in silico     1   GGCTGGAGTACTCTTTGAGGACATCTTCAACGTAAAGGACATGGATCCGGAGGGCAAAAA 60


11246R-3.IR_full       61  GTTCGACCGTGTATCCCGCCTGCACTGCGAGTCCGAGTCGTTTAAGATGGACCTCATCCT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11246R-3.in silico     61  GTTCGACCGTGTATCCCGCCTGCACTGCGAGTCCGAGTCGTTTAAGATGGACCTCATCCT 120


11246R-3.IR_full       121 GGACATCAACTCGTGGCTATACCCCATGGAGCTGGGCGACAAGTTCCGCCTGGTTTTGGC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11246R-3.in silico     121 GGACATCAACTCGTGGCTATACCCCATGGAGCTGGGCGACAAGTTCCGCCTGGTTTTGGC 180


11246R-3.IR_full       181 CACCACCCTGCGCGAGGATGGTTGCCCGGACAGCGGGGAGTACAATCCAATGGAGCACGA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11246R-3.in silico     181 CACCACCCTGCGCGAGGATGGTTGCCCGGACAGCGGGGAGTACAATCCAATGGAGCACGA 240


11246R-3.IR_full       241 GGGAACGCGGGCGGACAGCTTTGAGTACGTGATGTACGGCAAGATCTACAGGATCGAGGG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11246R-3.in silico     241 GGGAACGCGGGCGGACAGCTTTGAGTACGTGATGTACGGCAAGATCTACAGGATCGAGGG 300


11246R-3.IR_full       301 CGACGAAGCACACAATGAGGCCTCCCGGCTCTCCGCCTACGTGTCATTCGGCGGCTTGCT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11246R-3.in silico     301 CGACGAAGCACACAATGAGGCCTCCCGGCTCTCCGCCTACGTGTCATTCGGCGGCTTGCT 360


11246R-3.IR_full       361 GATGCGACTTCAGGGTGACGCCAACAATCTTCATGGCTTCGAGGTGGACCAGCACATGTA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11246R-3.in silico     361 GATGCGACTTCAGGGTGACGCCAACAATCTTCATGGCTTCGAGGTGGACCAGCACATGTA 420


11246R-3.IR_full       421 CCTGCTGATGAAGCGGC 437
                           |||||||||||||||||
11246R-3.in silico     421 CCTGCTGATGAAGCGGC 437

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   419  NM_141095.2  CG11246-RA (Rpb8), mRNA 
0   NM_080110.2  CG32356-RA, transcript variant A (ImpE1), mRNA 
0   NM_168270.1  CG32356-RB, transcript variant B (ImpE1), mRNA 
0   NM_138985.2  CG8947-RA (26-29-p), mRNA 
0   NM_168002.2  CG32277-RA (CG32277), mRNA 
0   NM_135739.2  CG5781-RA (CG5781), mRNA 
0   NM_078672.3  CG7113-RA (scu), mRNA 
0   NM_131930.1  CG15572-RA (CG15572), mRNA 
0   NM_166019.1  CG18076-RH, transcript variant H (shot), mRNA 
0   NM_058026.3  CG5709-RA (ari-2), mRNA 
0   NM_131924.2  CG4857-RB (CG4857), mRNA 
0   NM_164461.1  CG7082-RA, transcript variant A (CG7082), mRNA 
0   NM_134813.2  CG7082-RC, transcript variant C (CG7082), mRNA 
0   NM_164462.1  CG7082-RB, transcript variant B (CG7082), mRNA 
0   NM_164463.1  CG7082-RD, transcript variant D (CG7082), mRNA 
0   NM_135477.2  CG5885-RA (CG5885), mRNA 
0   NM_169016.1  CG9765-RB, transcript variant B (tacc), mRNA 
0   NM_058086.2  CG9765-RA, transcript variant A (tacc), mRNA 
0   NM_176401.1  CG9765-RD, transcript variant D (tacc), mRNA 
0   NM_058085.4  CG9765-RC, transcript variant C (tacc), mRNA 
0   NM_136640.2  CG8801-RA (CG8801), mRNA 
0   NM_140809.2  CG3945-RA (Rad9), mRNA 
0   NM_140885.1  CG8756-RD, transcript variant D (LCBP1), mRNA 
0   NM_168809.1  CG8756-RA, transcript variant A (LCBP1), mRNA 
0   NM_168810.1  CG8756-RB, transcript variant B (LCBP1), mRNA 
0   NM_168808.1  CG8756-RC, transcript variant C (LCBP1), mRNA 
0   NM_058056.3  CG10382-RA (wrapper), mRNA 
0   NM_057362.2  CG17579-RA, transcript variant A (sca), mRNA 
0   NM_165951.1  CG17579-RB, transcript variant B (sca), mRNA 
0   NM_142244.1  CG4546-RA (CG4546), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.