National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11181R-1 
 Symbol cup  Full Name cup 
 CG No CG11181  Old CG No CG11181 
 Synonyms CUP, Cup, fs(2)cup, i239, CG11181, fs(1)cup, cup 
 Accession No (Link to NCBI) NM_078769.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGGACCCTATGAAAGAGGAG 
 Primer Seq. 3'
aatctagaggtaccTGATGGAACGAGAAGACTCAG 
 Predicted Fragment Size
499 
 IR fragment full Seq
0001 ATGGACCCTA TGAAAGAGGA GGCGATCGAA TTGAATGGCC ATGCTATGCA AATGGCCGAA 
0061 GCTGAGCAAG AAAATGGCGC TGGCGCCCTG AAAAATTGCC ACCAATGCGG GTGCAACCGA 
0121 TCGTCCAGCG CATCAGCAGC TTCCGCTGCC AGTCGAAGAT CAGCAGGATG AGGTGCTGAC 
0181 CCCCGCTGAG AAGGGCAAGT TCGAGTACCC TCCCCCTCCA CCGCCACCAA CTCCAGTCCA 
0241 GGCTCCGCTA GCCACCAAGG CCACCGCTCT GAATGCCAGT CAAGAGCATG ACGACGACGA 
0301 GGCCAACTCC GAGAAGTGGG AGGATNCCGT NNTGCGCTCC gNCCCCGCCT CCTCCGCTGC 
0361 CGACTAGCGC TTTCCTGGCC ACCGGACTGG GCTACCTCAA GCTGCCCGCC TTCAAGCTGA 
0421 AGGACGCACT GGAGAAGGCC ATCACCAAGT TGGAGGCCAA CAAGCGGACG CTAAAGGCCA 
0481 GCCCTGAGTC TTCTCGTTCC ATCA 
 in silico PCR Fragment
0001 ATGGACCCTA TGAAAGAGGA GGCGATCGAA TTGAATGGCC ATGCTATGCA AATGGCCGAA 
0061 GCTGAGCAAG AAAATGGCGC TGGCGCCCTG -AAAATTGCC ACCAATGCGG GTGCAACCGA 
0121 TCGTCCAGCG CATCAGCAGC TTCCGCTGCC AGTCGAAGAT CAGCAGGATG AGGTGCTGAC 
0181 CCCCGCTGAG AAGGGCAAGT TCGAGTACCC GCCCCCTCCA CCGCCACCAA CTCCAGTCCA 
0241 GGCTCCGCTA GCCACCAAGG CCACCGCTCT GAATGCCAGT CAAGAGCATG ACGACGACGA 
0301 GGCCAACTCC GAGAAGTGGG AGGAT-CCG- --TGCGCTCC GCCCCCGCCT CCTCCGCTGC 
0361 CGACTAGCGC TTTCCTGGCC ACCGGACTGG GCTACCTCAA GCTGCCCGCC TTCAAGCTGA 
0421 AGGACGCACT GGAGAAGGCC ATCACCAAGT TGGAGGCCAA CAAGCGGACG CTAAAGGCCA 
0481 GCCCTGAGTC TTCTCGTTCC ATCA 
 Assemble Data

11181R-1.IR_full       1   ATGGACCCTATGAAAGAGGAGGCGATCGAATTGAATGGCCATGCTATGCAAATGGCCGAA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11181R-1.in silico     1   ATGGACCCTATGAAAGAGGAGGCGATCGAATTGAATGGCCATGCTATGCAAATGGCCGAA 60


11181R-1.IR_full       61  GCTGAGCAAGAAAATGGCGCTGGCGCCCTGAAAAATTGCCACCAATGCGGGTGCAACCGA 120
                           |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
11181R-1.in silico     61  GCTGAGCAAGAAAATGGCGCTGGCGCCCTG-AAAATTGCCACCAATGCGGGTGCAACCGA 120


11181R-1.IR_full       121 TCGTCCAGCGCATCAGCAGCTTCCGCTGCCAGTCGAAGATCAGCAGGATGAGGTGCTGAC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11181R-1.in silico     121 TCGTCCAGCGCATCAGCAGCTTCCGCTGCCAGTCGAAGATCAGCAGGATGAGGTGCTGAC 180


11181R-1.IR_full       181 CCCCGCTGAGAAGGGCAAGTTCGAGTACCCTCCCCCTCCACCGCCACCAACTCCAGTCCA 240
                           |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
11181R-1.in silico     181 CCCCGCTGAGAAGGGCAAGTTCGAGTACCCGCCCCCTCCACCGCCACCAACTCCAGTCCA 240


11181R-1.IR_full       241 GGCTCCGCTAGCCACCAAGGCCACCGCTCTGAATGCCAGTCAAGAGCATGACGACGACGA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11181R-1.in silico     241 GGCTCCGCTAGCCACCAAGGCCACCGCTCTGAATGCCAGTCAAGAGCATGACGACGACGA 300


11181R-1.IR_full       301 GGCCAACTCCGAGAAGTGGGAGGATNCCGTNNTGCGCTCCGNCCCCGCCTCCTCCGCTGC 360
                           ||||||||||||||||||||||||| |||   ||||||||| ||||||||||||||||||
11181R-1.in silico     301 GGCCAACTCCGAGAAGTGGGAGGAT-CCG---TGCGCTCCGCCCCCGCCTCCTCCGCTGC 360


11181R-1.IR_full       361 CGACTAGCGCTTTCCTGGCCACCGGACTGGGCTACCTCAAGCTGCCCGCCTTCAAGCTGA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11181R-1.in silico     361 CGACTAGCGCTTTCCTGGCCACCGGACTGGGCTACCTCAAGCTGCCCGCCTTCAAGCTGA 420


11181R-1.IR_full       421 AGGACGCACTGGAGAAGGCCATCACCAAGTTGGAGGCCAACAAGCGGACGCTAAAGGCCA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11181R-1.in silico     421 AGGACGCACTGGAGAAGGCCATCACCAAGTTGGAGGCCAACAAGCGGACGCTAAAGGCCA 480


11181R-1.IR_full       481 GCCCTGAGTCTTCTCGTTCCATCA 504
                           ||||||||||||||||||||||||
11181R-1.in silico     481 GCCCTGAGTCTTCTCGTTCCATCA 504

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   481  NM_078769.2  CG11181-RA (cup), mRNA 
0.2   NM_176464.1  CG31211-RB, transcript variant B (CG31211), mRNA 
0.2   NM_141874.2  CG31211-RA, transcript variant A (CG31211), mRNA 
0.2   NM_176465.1  CG31211-RC, transcript variant C (CG31211), mRNA 
0   NM_176001.1  CG32982-RA, transcript variant A (CG32982), mRNA 
0   NM_138202.2  CG17183-RA (MED30), mRNA 
0   NM_168322.1  CG10537-RB, transcript variant B (Rdl), mRNA 
0   NM_079267.2  CG10537-RA, transcript variant A (Rdl), mRNA 
0   NM_168321.1  CG10537-RC, transcript variant C (Rdl), mRNA 
0   NM_057224.3  CG4694-RA (her), mRNA 
0   14  NM_058088.3  CG8730-RA (drosha), mRNA 
0   12  NM_168168.1  CG32396-RA (CG32396), mRNA 
0   18  NM_136191.2  CG31688-RA (CG31688), mRNA 
0   NM_080300.1  CG14808-RA (Scgdelta), mRNA 
0   NM_167329.2  CG17762-RC, transcript variant C (tomosyn), mRNA 
0   NM_140364.2  CG11259-RA (MICAL-like), mRNA 
0   NM_079419.2  CG4059-RB, transcript variant B (ftz-f1), mRNA 
0   NM_139738.1  CG10489-RA (Pole2), mRNA 
0   NM_168775.1  CG4059-RA, transcript variant A (ftz-f1), mRNA 
0   NM_057785.3  CG5373-RA (Pi3K59F), mRNA 
0   18  NM_168294.1  CG32030-RB, transcript variant B (CG32030), mRNA 
0   18  NM_168293.1  CG32030-RA, transcript variant A (CG32030), mRNA 
0   11  NM_176144.1  CG33144-RA (CG33144), mRNA 
0   10  NM_132652.2  CG1987-RA (Rbp1-like), mRNA 
0   NM_078689.2  CG14228-RA (Mer), mRNA 
0   NM_141416.3  CG15179-RA (sunz), mRNA 
0   NM_137752.2  CG10320-RA (CG10320), mRNA 
0   NM_142869.3  CG4656-RA (CG4656), mRNA 
0   NM_142812.1  CG13843-RA (CG13843), mRNA 
0   11  63  NM_167493.1  CG3606-RA, transcript variant A (caz), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
+- 
DC
DM
+- 
VM
 
VB
+- 
Caspase-3 signal
N
DB
++ 
DC
++ 
DM
VM
VB
++ 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.