National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11180R-2 
 Symbol CG11180  Full Name CG11180 
 CG No CG11180  Old CG No CG11180 
 Synonyms CG11180 
 Accession No (Link to NCBI) NM_137651.1 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Yano H, Yamamoto-Hino M, Awano W, Aoki-Kinoshita KF, Tsuda-Sakurai K, Okano H, Goto S.
Identification of proteasome components required for apical localization of Chaoptin using functional genomics.
J. Neurogenet. (2012) 26(1) 53-63 [ PubMed ID = 22417167 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGGGCTGGACGAAAGGCAGT 
 Primer Seq. 3'
aatctagaggtaccGTCTGCACGCCAGCGAAGTTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGGGCTGGA CGAAAGGCAG TGGCCTGGGC GCCAATCTGA ATGGCGAAAA GGATTTTGTG 
0061 CGCATTCGCT TTAAAAATGA CGCAGAAGGA TTGGGTTTCG AGCAGCGCGA TNGATCAGTG 
0121 GACTGTACAC GAGGATGGCT TCAATGGGCT GCTTAAGTCG CTAAATGGGG AAGATAGCGG 
0181 CGGCATAGAC AAAGAGCCGG AGTCCGAAGA GGAGGCCAGA CCTATGGGCT TTGGCTTCAA 
0241 AGCCATTGAA CCGGAGGAGC CGTCTAAGAA GAAACTCAAG GAGAACACCA GTGGAATGTC 
0301 GCTGGAGGAG CGGTCGAAGC AGAGCAGGGC ACGCGTCCAC TATAAGAAGT TCACACGCGG 
0361 CAAGGACTTG GCTCTGTACA GCGAAAAGGA TCTAGCCAAT ATATTCGGCA AGAAGGCAAC 
0421 TGAGGACGTC GAGAGATATC CAGAACCCGT GCTGGCTGTC CAACCCGAGG AGCCAAACCC 
0481 CAACTTCGCT GGCGTGCAGA C 
 in silico PCR Fragment
0001 ATGGGCTGGA CGAAAGGCAG TGGCCTGGGC GCCAATCTGA ATGGCGAAAA GGATTTTGTG 
0061 CGCATTCGCT TTAAAAATGA CGCAGAAGGA TTGGGTTTCG AGCAGCGCGA T-GATCAGTG 
0121 GACTGTACAC GAGGATGGCT TCAATGGGCT GCTTAAGTCG CTAAATGGGG AAGATAGCGG 
0181 CGGCATAGAC AAAGAGCCGG AGTCCGAAGA GGAGGCCAGA CCTATGGGCT TTGGCTTCAA 
0241 AGCCATTGAA CCGGAGGAGC CGTCTAAGAA GAAACTCAAG GAGAACACCA GTGGAATGTC 
0301 GCTGGAGGAG CGGTCGAAGC AGAGCAGGGC ACGCGTCCAC TATAAGAAGT TCACACGCGG 
0361 CAAGGACTTG GCTCTGTACA GCGAAAAGGA TCTAGCCAAT ATATTCGGCA AGAAGGCAAC 
0421 TGAGGACGTC GAGAGATATC CAGAACCCGT GCTGGCTGTC CAACCCGAGG AGCCAAACCC 
0481 CAACTTCGCT GGCGTGCAGA C 
 Assemble Data

11180R-2.IR_full       1   ATGGGCTGGACGAAAGGCAGTGGCCTGGGCGCCAATCTGAATGGCGAAAAGGATTTTGTG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11180R-2.in silico     1   ATGGGCTGGACGAAAGGCAGTGGCCTGGGCGCCAATCTGAATGGCGAAAAGGATTTTGTG 60


11180R-2.IR_full       61  CGCATTCGCTTTAAAAATGACGCAGAAGGATTGGGTTTCGAGCAGCGCGATNGATCAGTG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
11180R-2.in silico     61  CGCATTCGCTTTAAAAATGACGCAGAAGGATTGGGTTTCGAGCAGCGCGAT-GATCAGTG 120


11180R-2.IR_full       121 GACTGTACACGAGGATGGCTTCAATGGGCTGCTTAAGTCGCTAAATGGGGAAGATAGCGG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11180R-2.in silico     121 GACTGTACACGAGGATGGCTTCAATGGGCTGCTTAAGTCGCTAAATGGGGAAGATAGCGG 180


11180R-2.IR_full       181 CGGCATAGACAAAGAGCCGGAGTCCGAAGAGGAGGCCAGACCTATGGGCTTTGGCTTCAA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11180R-2.in silico     181 CGGCATAGACAAAGAGCCGGAGTCCGAAGAGGAGGCCAGACCTATGGGCTTTGGCTTCAA 240


11180R-2.IR_full       241 AGCCATTGAACCGGAGGAGCCGTCTAAGAAGAAACTCAAGGAGAACACCAGTGGAATGTC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11180R-2.in silico     241 AGCCATTGAACCGGAGGAGCCGTCTAAGAAGAAACTCAAGGAGAACACCAGTGGAATGTC 300


11180R-2.IR_full       301 GCTGGAGGAGCGGTCGAAGCAGAGCAGGGCACGCGTCCACTATAAGAAGTTCACACGCGG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11180R-2.in silico     301 GCTGGAGGAGCGGTCGAAGCAGAGCAGGGCACGCGTCCACTATAAGAAGTTCACACGCGG 360


11180R-2.IR_full       361 CAAGGACTTGGCTCTGTACAGCGAAAAGGATCTAGCCAATATATTCGGCAAGAAGGCAAC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11180R-2.in silico     361 CAAGGACTTGGCTCTGTACAGCGAAAAGGATCTAGCCAATATATTCGGCAAGAAGGCAAC 420


11180R-2.IR_full       421 TGAGGACGTCGAGAGATATCCAGAACCCGTGCTGGCTGTCCAACCCGAGGAGCCAAACCC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11180R-2.in silico     421 TGAGGACGTCGAGAGATATCCAGAACCCGTGCTGGCTGTCCAACCCGAGGAGCCAAACCC 480


11180R-2.IR_full       481 CAACTTCGCTGGCGTGCAGAC 501
                           |||||||||||||||||||||
11180R-2.in silico     481 CAACTTCGCTGGCGTGCAGAC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  13  NM_137651.1  CG11180-RA (CG11180), mRNA 
0   NM_168218.1  CG32372-RA (CG32372), mRNA 
0   NM_137841.2  CG4046-RA (RpS16), mRNA 
0   NM_140349.2  CG10948-RB, transcript variant B (CG10948), mRNA 
0   NM_168524.1  CG10948-RC, transcript variant C (CG10948), mRNA 
0   NM_168525.1  CG10948-RA, transcript variant A (CG10948), mRNA 
0   NM_137847.2  CG4207-RA (bonsai), mRNA 
0   13  NM_001043240.1  CG34114-RB (CG34114), mRNA 
0   NM_167218.1  CG32685-RC (CG32685), mRNA 
0   NM_169997.3  CG31163-RB, transcript variant B (CG31163), mRNA 
0   NM_001043277.1  CG31163-RD, transcript variant D (CG31163), mRNA 
0   NM_165961.1  CG3845-RA, transcript variant A (l(2)01424), mRNA 
0   NM_001038854.1  CG3845-RC, transcript variant C (l(2)01424), mRNA 
0   NM_143770.2  CG3845-RB, transcript variant B (l(2)01424), mRNA 
0   NM_141073.1  CG7173-RA (CG7173), mRNA 
0   NM_142273.2  CG12785-RA (CG12785), mRNA 
0   NM_140326.1  CG10654-RA (CG10654), mRNA 
0   NM_078541.3  CG9022-RA (Ost48), mRNA 
0   NM_078658.2  CG8922-RA (RpS5a), mRNA 
0   NM_135752.2  CG12404-RA (CG12404), mRNA 
0   NM_139542.1  CG12009-RA (CG12009), mRNA 
0   NM_001015318.1  CG40163-PA.3 (CG40163), mRNA 
0   NM_136764.2  CG12340-RA (CG12340), mRNA 
0   NM_001042877.1  CG13778-RC, transcript variant C (Mnn1), mRNA 
0   NM_136086.4  CG31793-RA (CG31793), mRNA 
0   NM_140564.1  CG17029-RA (CG17029), mRNA 
0   NM_058090.2  CG7121-RA (Tehao), mRNA 
0   NM_143442.1  CG7567-RA (CG7567), mRNA 
0   NM_001014624.1  CG33555-RC, transcript variant C (btsz), mRNA 
0   NM_134763.1  CG14351-RA (CG14351), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.