National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11178R-1 
 Symbol CG11178  Full Name CG11178 
 CG No CG11178  Old CG No CG11178 
 Synonyms CG11178 
 Accession No (Link to NCBI) NM_167377.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Kobayashi M, Michaut L, Ino A, Honjo K, Nakajima T, Maruyama Y, Mochizuki H, Ando M, Ghangrekar I, Takahashi K, Saigo K, Ueda R, Gehring WJ, Furukubo-Tokunaga K.
Differential microarray analysis of Drosophila mushroom body transcripts using chemical ablation.
Proc. Natl. Acad. Sci. U.S.A. (2006) 103(39) 14417-22 [ PubMed ID = 16971484 ] [ RRC reference ]

Kamimura K, Koyama T, Habuchi H, Ueda R, Masu M, Kimata K, Nakato H.
Specific and flexible roles of heparan sulfate modifications in Drosophila FGF signaling.
J. Cell Biol. (2006) 174(6) 773-8 [ PubMed ID = 16966419 ] [ RRC reference ]

Rauskolb C, Pan G, Reddy BV, Oh H, Irvine KD.
Zyxin links fat signaling to the hippo pathway.
PLoS Biol. (2011) 9(6) e1000624 [ PubMed ID = 21666802 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGAGAACAAGCCACCGATCCTG 
 Primer Seq. 3'
aatctagaggtaccACGTGAAAGTGGCGCAACGGG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GAGAACAAGC CACCGATCCT GCACATCCTC GTGGTGGGCT TCCACCACAA GCTGGGCTGC 
0061 CAGGTGGAGT TCTCGCATCC GCCGCTAATC TCGGGCTCCA CGGGACGCAA CGAATGCCCC 
0121 TCCGGCTGGA AGTACCTGCC CACTCTGGCT CTGcCCGACG GCTCGCATAA CTTTGCCGAG 
0181 GACACGGTGT TCTTCAACCT GCCCAGTTTG TATGAGCCGG CTGAGAGTAT CTACGGCGTG 
0241 TCCTGCTATC GCCAGATACG CGTGGAGAAG CTAAAGATCC GGACAGCGGA CCTCACGCGC 
0301 AGCACCGTTC AGAAGTCCGT TTGCATATTG GCCCGCCTGC CCATCTACGG GTACATCGAG 
0361 GTGAAGCTAG CCCTCATTGC CGATGCCTTT TTCGATCAGG GCGACTTCTC CGGCACGGAA 
0421 CTGCTGGTCA AGGCCTATCA GCAGCTAAAT GCCTGCCTCC AGGACGACGA TGTCGCGCCG 
0481 CCCGTTGCGC CACTTTCACG T 
 in silico PCR Fragment
0001 GAGAACAAGC CACCGATCCT GCACATCCTC GTGGTGGGCT TCCACCACAA GCTGGGCTGC 
0061 CAGGTGGAGT TCTCGCATCC GCCGCTAATC TCGGGCTCCA CGGGACGCAA CGAATGCCCC 
0121 TCCGGCTGGA AGTACCTGCC CACTCTGGCT CTGCCCGACG GCTCGCATAA CTTTGCCGAG 
0181 GACACGGTGT TCTTCAACCT GCCCAGTTTG TATGAGCCGG CTGAGAGTAT CTACGGCGTG 
0241 TCCTGCTATC GCCAGATACG CGTGGAGAAG CTAAAGATCC GGACAGCGGA CCTCACGCGC 
0301 AGCACCGTTC AGAAGTCCGT TTGCATATTG GCCCGCCTGC CCATCTACGG GTACATCGAG 
0361 GTGAAGCTAG CCCTCATTGC CGATGCCTTT TTCGATCAGG GCGACTTCTC CGGCACGGAA 
0421 CTGCTGGCCA AGGCCTATCA GCAGCTAAAT GCCTGCCTCC AGGACGACGA -GTCGCGCCG 
0481 CCCGTTGCGC CACTTTCACG T 
 Assemble Data

11178R-1.IR_full       1   GAGAACAAGCCACCGATCCTGCACATCCTCGTGGTGGGCTTCCACCACAAGCTGGGCTGC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11178R-1.in silico     1   GAGAACAAGCCACCGATCCTGCACATCCTCGTGGTGGGCTTCCACCACAAGCTGGGCTGC 60


11178R-1.IR_full       61  CAGGTGGAGTTCTCGCATCCGCCGCTAATCTCGGGCTCCACGGGACGCAACGAATGCCCC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11178R-1.in silico     61  CAGGTGGAGTTCTCGCATCCGCCGCTAATCTCGGGCTCCACGGGACGCAACGAATGCCCC 120


11178R-1.IR_full       121 TCCGGCTGGAAGTACCTGCCCACTCTGGCTCTGCCCGACGGCTCGCATAACTTTGCCGAG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11178R-1.in silico     121 TCCGGCTGGAAGTACCTGCCCACTCTGGCTCTGCCCGACGGCTCGCATAACTTTGCCGAG 180


11178R-1.IR_full       181 GACACGGTGTTCTTCAACCTGCCCAGTTTGTATGAGCCGGCTGAGAGTATCTACGGCGTG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11178R-1.in silico     181 GACACGGTGTTCTTCAACCTGCCCAGTTTGTATGAGCCGGCTGAGAGTATCTACGGCGTG 240


11178R-1.IR_full       241 TCCTGCTATCGCCAGATACGCGTGGAGAAGCTAAAGATCCGGACAGCGGACCTCACGCGC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11178R-1.in silico     241 TCCTGCTATCGCCAGATACGCGTGGAGAAGCTAAAGATCCGGACAGCGGACCTCACGCGC 300


11178R-1.IR_full       301 AGCACCGTTCAGAAGTCCGTTTGCATATTGGCCCGCCTGCCCATCTACGGGTACATCGAG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11178R-1.in silico     301 AGCACCGTTCAGAAGTCCGTTTGCATATTGGCCCGCCTGCCCATCTACGGGTACATCGAG 360


11178R-1.IR_full       361 GTGAAGCTAGCCCTCATTGCCGATGCCTTTTTCGATCAGGGCGACTTCTCCGGCACGGAA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11178R-1.in silico     361 GTGAAGCTAGCCCTCATTGCCGATGCCTTTTTCGATCAGGGCGACTTCTCCGGCACGGAA 420


11178R-1.IR_full       421 CTGCTGGTCAAGGCCTATCAGCAGCTAAATGCCTGCCTCCAGGACGACGATGTCGCGCCG 480
                           ||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||
11178R-1.in silico     421 CTGCTGGCCAAGGCCTATCAGCAGCTAAATGCCTGCCTCCAGGACGACGA-GTCGCGCCG 480


11178R-1.IR_full       481 CCCGTTGCGCCACTTTCACGT 501
                           |||||||||||||||||||||
11178R-1.in silico     481 CCCGTTGCGCCACTTTCACGT 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_167377.1  CG11178-RA, transcript variant A (CG11178), mRNA 
100   482  NM_132673.2  CG11178-RB, transcript variant B (CG11178), mRNA 
0   NM_167265.1  CG2061-RC, transcript variant C (CG2061), mRNA 
0   NM_132454.4  CG2061-RA, transcript variant A (CG2061), mRNA 
0   NM_167264.1  CG2061-RB, transcript variant B (CG2061), mRNA 
0   NM_080014.2  CG3064-RB (futsch), mRNA 
0   NM_206576.1  CG6095-RB, transcript variant B (CG6095), mRNA 
0   NM_143197.1  CG6095-RA, transcript variant A (CG6095), mRNA 
0   NM_079731.1  CG17241-RA (Or94a), mRNA 
0   NM_079543.2  CG1257-RA (alpha-Est3), mRNA 
0   NM_141281.2  CG2087-RA (PEK), mRNA 
0   NM_167474.1  CG8909-RB (CG8909), mRNA 
0   NM_001014640.1  CG14299-RB, transcript variant B (CG14299), mRNA 
0   NM_142495.1  CG14299-RA, transcript variant A (CG14299), mRNA 
0   NM_170177.2  CG3744-RB, transcript variant B (CG3744), mRNA 
0   NM_206569.1  CG3744-RC, transcript variant C (CG3744), mRNA 
0   NM_143047.2  CG3744-RA, transcript variant A (CG3744), mRNA 
0   NM_170540.1  CG31004-RB, transcript variant B (CG31004), mRNA 
0   NM_170539.1  CG31004-RA, transcript variant A (CG31004), mRNA 
0   NM_080305.2  CG10755-RA (Cyp4ae1), mRNA 
0   NM_143725.2  CG18039-RA (KaiRIA), mRNA 
0   NM_169003.2  CG31522-RA, transcript variant A (CG31522), mRNA 
0   NM_169002.2  CG31522-RD, transcript variant D (CG31522), mRNA 
0   NM_169001.2  CG31522-RB, transcript variant B (CG31522), mRNA 
0   NM_140158.1  CG6409-RA (CG6409), mRNA 
0   NM_169475.1  CG17369-RA, transcript variant A (Vha55), mRNA 
0   NM_057560.3  CG17369-RB, transcript variant B (Vha55), mRNA 
0   NM_132191.2  CG10946-RA (dpr14), mRNA 
0   NM_136649.1  CG12932-RA (CG12932), mRNA 
0   NM_079258.2  CG5939-RA, transcript variant A (Prm), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.