National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11175R-2 
 Symbol CG11175  Full Name CG11175 
 CG No CG11175  Old CG No CG11175 
 Synonyms CG11175 
 Accession No (Link to NCBI) NM_137653.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCCGGGCAACGGCAATAGCATA 
 Primer Seq. 3'
aatctagaggtaccCTGGTGGCCAATCCTTGCAGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CCGGGCAACG GCAATAGCAT ACAAAACTTT TGGAACGATC GCATTATGGA GCGCTTCATA 
0061 AAGGCGAATC TATTCATTAT CTGCTGCGTG GTGGCGGTTC TATTGCTGAT CGTCTATCTG 
0121 GGTGCCTTCT CGTGTGAGGT CTCGTGGATA CTGGAGGCCC ACGGCGAGCT GCCCTTCGCC 
0181 GCCTACACGC TCTGCTCGCT CTACTTTGTC ATGTTCGTGG CCACCACGAT CCTTATCCAC 
0241 GGCCTGGTCA GCGGACTCTG CTGGCCGTTG TTCGCCTGGT CGGGCATCAT CGGTCTCCTC 
0301 TCGATTCCAG AGCTGGTCTT TGTCATGATC ATGACCACAC AGCACTGGGG TCTGCAATCT 
0361 GTGCATGGAT TGACGGAGCT CACTTCCTAT CTGATTCGCC TCATCATCAA CTGCTTCGCG 
0421 CTGATCTGTG TGATTCCCAC GGGCATCAGG TGGCGACGGG AGACTCAGGT GTTGAGTCAG 
0481 CTGCAAGGAT TGGCCACCAG  
 in silico PCR Fragment
0001 CCGGGCAACG GCAATAGCAT ACAAAACTTT TGGAACGATC GCATTATGGA GCGCTTCATA 
0061 AAGGCGAATC TATTCATTAT CTGCTGCGTG GTGGCGGTTC TATTGCTGAT CGTCTATCTG 
0121 GGTGCCTTCT CGTGTGAGGT CTCGTGGATA CTGGAGGCCC ACGGCGAGCT GCCCTTCGCC 
0181 GCCTACACGC TCTGCTCGCT CTACTTTGTC ATGTTCGTGG CCACCACGAT CCTTATCCAC 
0241 GGCCTGGTCA GCGGACTCTG CTGGCCGTTG TTCGCCTGGT CGGGCATCAT CGGTCTCCTC 
0301 TCAATTCCAG AGCTGGTCTT TGTCATGATC ATGACCACAC AGCACTGGGG TCTGCAATCT 
0361 GTGCATGGAT TAACGGAGCT CACCTCCTAC CTGATTCGCC TCATCATCAA CTGCTTCGCG 
0421 CTGATCTGTG TGATTCCCAC GGGCATCAGG TGGCGACGGG AGACTCAGGT GTTGAGTCAG 
0481 CTGCAAGGAT TGGCCACCAG  
 Assemble Data

11175R-2.IR_full       1   CCGGGCAACGGCAATAGCATACAAAACTTTTGGAACGATCGCATTATGGAGCGCTTCATA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11175R-2.in silico     1   CCGGGCAACGGCAATAGCATACAAAACTTTTGGAACGATCGCATTATGGAGCGCTTCATA 60


11175R-2.IR_full       61  AAGGCGAATCTATTCATTATCTGCTGCGTGGTGGCGGTTCTATTGCTGATCGTCTATCTG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11175R-2.in silico     61  AAGGCGAATCTATTCATTATCTGCTGCGTGGTGGCGGTTCTATTGCTGATCGTCTATCTG 120


11175R-2.IR_full       121 GGTGCCTTCTCGTGTGAGGTCTCGTGGATACTGGAGGCCCACGGCGAGCTGCCCTTCGCC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11175R-2.in silico     121 GGTGCCTTCTCGTGTGAGGTCTCGTGGATACTGGAGGCCCACGGCGAGCTGCCCTTCGCC 180


11175R-2.IR_full       181 GCCTACACGCTCTGCTCGCTCTACTTTGTCATGTTCGTGGCCACCACGATCCTTATCCAC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11175R-2.in silico     181 GCCTACACGCTCTGCTCGCTCTACTTTGTCATGTTCGTGGCCACCACGATCCTTATCCAC 240


11175R-2.IR_full       241 GGCCTGGTCAGCGGACTCTGCTGGCCGTTGTTCGCCTGGTCGGGCATCATCGGTCTCCTC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11175R-2.in silico     241 GGCCTGGTCAGCGGACTCTGCTGGCCGTTGTTCGCCTGGTCGGGCATCATCGGTCTCCTC 300


11175R-2.IR_full       301 TCGATTCCAGAGCTGGTCTTTGTCATGATCATGACCACACAGCACTGGGGTCTGCAATCT 360
                           || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11175R-2.in silico     301 TCAATTCCAGAGCTGGTCTTTGTCATGATCATGACCACACAGCACTGGGGTCTGCAATCT 360


11175R-2.IR_full       361 GTGCATGGATTGACGGAGCTCACTTCCTATCTGATTCGCCTCATCATCAACTGCTTCGCG 420
                           ||||||||||| ||||||||||| ||||| ||||||||||||||||||||||||||||||
11175R-2.in silico     361 GTGCATGGATTAACGGAGCTCACCTCCTACCTGATTCGCCTCATCATCAACTGCTTCGCG 420


11175R-2.IR_full       421 CTGATCTGTGTGATTCCCACGGGCATCAGGTGGCGACGGGAGACTCAGGTGTTGAGTCAG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11175R-2.in silico     421 CTGATCTGTGTGATTCCCACGGGCATCAGGTGGCGACGGGAGACTCAGGTGTTGAGTCAG 480


11175R-2.IR_full       481 CTGCAAGGATTGGCCACCAG 500
                           ||||||||||||||||||||
11175R-2.in silico     481 CTGCAAGGATTGGCCACCAG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  12  NM_137653.2  CG11175-RA (CG11175), mRNA 
0   NM_078688.2  CG14226-RA (dome), mRNA 
0   NM_167754.1  CG1417-RC, transcript variant C (slgA), mRNA 
0   NM_206804.1  CG1417-RG, transcript variant G (slgA), mRNA 
0   NM_206805.1  CG1417-RF, transcript variant F (slgA), mRNA 
0   NM_167753.1  CG1417-RB, transcript variant B (slgA), mRNA 
0   NM_167752.1  CG1417-RD, transcript variant D (slgA), mRNA 
0   NM_167751.1  CG1417-RA, transcript variant A (slgA), mRNA 
0   NM_078709.2  CG1417-RE, transcript variant E (slgA), mRNA 
0   NM_206803.1  CG1417-RH, transcript variant H (slgA), mRNA 
0   NM_132578.1  CG11146-RA (CG11146), mRNA 
0   NM_057992.2  CG5562-RA (gbb), mRNA 
0   NM_166513.1  CG11061-RB, transcript variant B (GM130), mRNA 
0   NM_137798.2  CG11061-RA, transcript variant A (GM130), mRNA 
0   NM_143497.2  CG7896-RA (CG7896), mRNA 
0   NM_136344.1  CG14470-RA (CG14470), mRNA 
0   NM_169082.1  CG31551-RA (CG31551), mRNA 
0   25  NM_080192.2  CG10449-RA (Catsup), mRNA 
0   NM_141562.1  CG11760-RB, transcript variant B (CG11760), mRNA 
0   NM_057841.3  CG5102-RA (da), mRNA 
0   NM_137519.2  CG15087-RA (CG15087), mRNA 
0   NM_135199.2  CG31637-RA (CG31637), mRNA 
0   NM_170094.2  CG13598-RA, transcript variant A (sba), mRNA 
0   NM_176549.1  CG13598-RB, transcript variant B (sba), mRNA 
0   NM_143270.2  CG6265-RA, transcript variant A (Nep5), mRNA 
0   NM_001031967.1  CG7749-RB, transcript variant B (fat2), mRNA 
0   NM_140914.2  CG7749-RA, transcript variant A (fat2), mRNA 
0   NM_170307.1  CG6265-RB, transcript variant B (Nep5), mRNA 
0   NM_167396.1  CG32604-RB, transcript variant B (l(1)G0007), mRNA 
0   NM_132719.2  CG32604-RA, transcript variant A (l(1)G0007), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.