National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11175R-1 
 Symbol CG11175  Full Name CG11175 
 CG No CG11175  Old CG No CG11175 
 Synonyms CG11175 
 Accession No (Link to NCBI) NM_137653.2 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CCGGGCAACGGCAATAGCATACAAAACTTTTGGAACGATCGCATTATGGAGCGCTTCATA 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  AAGGCGAATCTATTCATTATCTGCTGCGTGGTGGCGGTTCTATTGCTGATCGTCTATCTG 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GGTGCCTTCTCGTGTGAGGTCTCGTGGATACTGGAGGCCCACGGCGAGCTGCCCTTCGCC 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GCCTACACGCTCTGCTCGCTCTACTTTGTCATGTTCGTGGCCACCACGATCCTTATCCAC 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GGCCTGGTCAGCGGACTCTGCTGGCCGTTGTTCGCCTGGTCGGGCATCATCGGTCTCCTC 300

                           || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TCAATTCCAGAGCTGGTCTTTGTCATGATCATGACCACACAGCACTGGGGTCTGCAATCT 360

                           ||||||||||| ||||||||||| ||||| |||||||||||||||||||||||||||||| silico     361 GTGCATGGATTAACGGAGCTCACCTCCTACCTGATTCGCCTCATCATCAACTGCTTCGCG 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CTGATCTGTGTGATTCCCACGGGCATCAGGTGGCGACGGGAGACTCAGGTGTTGAGTCAG 480

11175R-1.IR_full       481 CTGCAAGGATTGGCCACCAG 500
                           |||||||||||||||||||| silico     481 CTGCAAGGATTGGCCACCAG 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  12  NM_137653.2  CG11175-RA (CG11175), mRNA 
0   NM_078688.2  CG14226-RA (dome), mRNA 
0   NM_167754.1  CG1417-RC, transcript variant C (slgA), mRNA 
0   NM_206804.1  CG1417-RG, transcript variant G (slgA), mRNA 
0   NM_206805.1  CG1417-RF, transcript variant F (slgA), mRNA 
0   NM_167753.1  CG1417-RB, transcript variant B (slgA), mRNA 
0   NM_167752.1  CG1417-RD, transcript variant D (slgA), mRNA 
0   NM_167751.1  CG1417-RA, transcript variant A (slgA), mRNA 
0   NM_078709.2  CG1417-RE, transcript variant E (slgA), mRNA 
0   NM_206803.1  CG1417-RH, transcript variant H (slgA), mRNA 
0   NM_132578.1  CG11146-RA (CG11146), mRNA 
0   NM_057992.2  CG5562-RA (gbb), mRNA 
0   NM_166513.1  CG11061-RB, transcript variant B (GM130), mRNA 
0   NM_137798.2  CG11061-RA, transcript variant A (GM130), mRNA 
0   NM_143497.2  CG7896-RA (CG7896), mRNA 
0   NM_136344.1  CG14470-RA (CG14470), mRNA 
0   NM_169082.1  CG31551-RA (CG31551), mRNA 
0   25  NM_080192.2  CG10449-RA (Catsup), mRNA 
0   NM_141562.1  CG11760-RB, transcript variant B (CG11760), mRNA 
0   NM_057841.3  CG5102-RA (da), mRNA 
0   NM_137519.2  CG15087-RA (CG15087), mRNA 
0   NM_135199.2  CG31637-RA (CG31637), mRNA 
0   NM_170094.2  CG13598-RA, transcript variant A (sba), mRNA 
0   NM_176549.1  CG13598-RB, transcript variant B (sba), mRNA 
0   NM_143270.2  CG6265-RA, transcript variant A (Nep5), mRNA 
0   NM_001031967.1  CG7749-RB, transcript variant B (fat2), mRNA 
0   NM_140914.2  CG7749-RA, transcript variant A (fat2), mRNA 
0   NM_170307.1  CG6265-RB, transcript variant B (Nep5), mRNA 
0   NM_167396.1  CG32604-RB, transcript variant B (l(1)G0007), mRNA 
0   NM_132719.2  CG32604-RA, transcript variant A (l(1)G0007), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.