National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11172R-3 
 Symbol NFAT  Full Name NFAT 
 CG No CG11172  Old CG No CG11172 
 Synonyms CG11172, NF-AT5, EP1335, NFAT5, dNFAT, MESR1, NFAT, Misexpression Suppressor of Ras 1, Rel domain protein, Drosophila TonEBP 
 Accession No (Link to NCBI) NM_078592.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees male lethal 
 Map Viewer
 Reference
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCAACAACAAGTTACGCGGCCC 
 Primer Seq. 3'
aatctagaggtaccTTGTTGCTGCTGCTGCTGCTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 NANCAACAAG TTACGCGGCC CGTGGAACAG GCATGAGAAT GACCATGTCC ACCAATTCCA 
0061 CAATGAGTGC GCGTATACAT CGAAAAGGAT TTCGCATACC ATCGAAAAGA CAGCCGGGTA 
0121 AGGGATTGCC CGGCAAGTTG CACACCATAA CCAGGACGGG TCCTGGCAAA ATGGTTCCTG 
0181 GGAAGCGAAT ACCACAGCGA CCCCATCCGC CGCCCTGCGA CAACTCGAAC GACAGTGGGC 
0241 TGGGTTTTGA TCAGCACACG GAGCTGAGAT CCTCGGCAGG AGCTGGAGGC GTAACCGATC 
0301 CGGCGGCCAA TGGAGGCAGT GGCTCCAACT CTGGCCAGCG ATCCAGTTTG CTGGTCAATA 
0361 GCGCTTTAAC CAACACANGT GGCTGCTGCA GCaGCcgAAG CAGCTGCCGC GGTGGCCCAG 
0421 CAACACGTTG CAGCAGCATC AGCAGCACCA TCAACAGCAG CAGCAGCAAC AGCAAGCAAC 
0481 AACAGCAGCA GCTTTGAGCA GCAACAa 
 in silico PCR Fragment
0001 CAACAACAAG TTACGCGGCC CGTGGAACAG GCATGAGAAT GACCATGTCC ACCAATTCCA 
0061 CAATGAGTGC GCGTATACAT CGAAAAGGAT TTCGCATACC ATCGAAAAGA CAGCCGGGTA 
0121 AGGGATTGCC CGGCAAGTTG CACACCATAA CCAGGACGGG TCCTGGCAAA ATGGTTCCTG 
0181 GGAAGCGAAT ACCACAGCGA CCCCATCCGC CGCCCTGCGA CAACTCGAAC GACAGTGGGC 
0241 TGGGTTTCGA TCAGCACACG GAGCTGAGAT CCTCGGCAGG AGCTGGGGGC GTTACTGATC 
0301 CGGCGGCCAA TGGAGGCAGT GGCTCCAACT CTGGCCAGCG ATCCAGTTTG CTGGTCAATA 
0361 GCGCTTTAAC CAACACA-GT GGCTGCTGCA GCAGCCGCAG CAGCTGCCGC GGTGG-CCAG 
0421 CAACACGTTG CAGCAGCATC AGCAGCACCA TCAACAGCAG CAGCAGCAAC AGC-AGCAAC 
0481 AACAGCAGCA GC----AGCA GCAACAA 
 Assemble Data

11172R-3.IR_full        1   ANCAACAAGTTACGCGGCCCGTGGAACAGGCATGAGAATGACCATGTCCACCAATTCCA 59
                            | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11172R-3.in silico      1   AACAACAAGTTACGCGGCCCGTGGAACAGGCATGAGAATGACCATGTCCACCAATTCCA 59


11172R-3.IR_full       61  CAATGAGTGCGCGTATACATCGAAAAGGATTTCGCATACCATCGAAAAGACAGCCGGGTA 119
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11172R-3.in silico     61  CAATGAGTGCGCGTATACATCGAAAAGGATTTCGCATACCATCGAAAAGACAGCCGGGTA 119


11172R-3.IR_full       121 AGGGATTGCCCGGCAAGTTGCACACCATAACCAGGACGGGTCCTGGCAAAATGGTTCCTG 179
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11172R-3.in silico     121 AGGGATTGCCCGGCAAGTTGCACACCATAACCAGGACGGGTCCTGGCAAAATGGTTCCTG 179


11172R-3.IR_full       181 GGAAGCGAATACCACAGCGACCCCATCCGCCGCCCTGCGACAACTCGAACGACAGTGGGC 239
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11172R-3.in silico     181 GGAAGCGAATACCACAGCGACCCCATCCGCCGCCCTGCGACAACTCGAACGACAGTGGGC 239


11172R-3.IR_full       241 TGGGTTTTGATCAGCACACGGAGCTGAGATCCTCGGCAGGAGCTGGAGGCGTAACCGATC 299
                           ||||||| |||||||||||||||||||||||||||||||||||||| ||||| || ||||
11172R-3.in silico     241 TGGGTTTCGATCAGCACACGGAGCTGAGATCCTCGGCAGGAGCTGGGGGCGTTACTGATC 299


11172R-3.IR_full       301 CGGCGGCCAATGGAGGCAGTGGCTCCAACTCTGGCCAGCGATCCAGTTTGCTGGTCAATA 359
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11172R-3.in silico     301 CGGCGGCCAATGGAGGCAGTGGCTCCAACTCTGGCCAGCGATCCAGTTTGCTGGTCAATA 359


11172R-3.IR_full       361 GCGCTTTAACCAACACANGTGGCTGCTGCAGCAGCCGAAGCAGCTGCCGCGGTGGCCCAG 419
                           ||||||||||||||||| ||||||||||||||||||| ||||||||||||||||| ||||
11172R-3.in silico     361 GCGCTTTAACCAACACA-GTGGCTGCTGCAGCAGCCGCAGCAGCTGCCGCGGTGG-CCAG 419


11172R-3.IR_full       421 CAACACGTTGCAGCAGCATCAGCAGCACCATCAACAGCAGCAGCAGCAACAGCAAGCAAC 479
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
11172R-3.in silico     421 CAACACGTTGCAGCAGCATCAGCAGCACCATCAACAGCAGCAGCAGCAACAGC-AGCAAC 479


11172R-3.IR_full       481 AACAGCAGCAGCTTTGAGCAGCAACAA 506
                           ||||||||||||    |||||||||||
11172R-3.in silico     481 AACAGCAGCAGC----AGCAGCAACAA 506

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
102.69  495  92  393  985  NM_078592.2  CG11172-RA (NFAT), mRNA 
26.55   128  1051  2775  5205  NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
26.55   128  1051  2775  5205  NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
26.55   128  1051  2775  5205  NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
12.03   58  256  785  1587  NM_079903.2  CG15319-RB (nej), mRNA 
11.41   55  181  606  1117  NM_167000.1  CG32778-RA (CG32778), mRNA 
9.95   48  281  872  1907  NM_168571.2  CG32133-RA (CG32133), mRNA 
9.75   47  146  466  1141  NM_137690.2  CG10543-RA, transcript variant A (CG10543), mRNA 
9.75   47  136  402  977  NM_166416.1  CG10543-RB, transcript variant B (CG10543), mRNA 
9.75   47  136  402  976  NM_176241.1  CG10543-RC, transcript variant C (CG10543), mRNA 
9.33   45  199  576  1157  NM_169258.1  CG9755-RA, transcript variant A (pum), mRNA 
9.33   45  199  576  1157  NM_169259.1  CG9755-RD, transcript variant D (pum), mRNA 
9.33   45  199  576  1157  NM_079561.2  CG9755-RC, transcript variant C (pum), mRNA 
9.12   44  401  1149  2373  NM_166030.1  CG8118-RB, transcript variant B (mam), mRNA 
9.12   44  401  1149  2373  NM_080376.1  CG8118-RA, transcript variant A (mam), mRNA 
8.29   40  167  357  781  NM_166992.2  CG2904-RA (ec), mRNA 
8.09   39  158  497  1138  NM_140402.2  CG17689-RA, transcript variant A (CG17689), mRNA 
8.09   39  122  444  1050  NM_078514.2  CG9653-RA (brk), mRNA 
7.88   38  177  570  1266  NM_132246.2  CG10555-RA (CG10555), mRNA 
7.67   37  200  545  1149  NM_057497.3  CG5058-RD, transcript variant D (grh), mRNA 
7.67   37  200  545  1149  NM_057496.3  CG5058-RC, transcript variant C (grh), mRNA 
7.46   36  247  773  1872  NM_135077.2  CG14023-RA (CG14023), mRNA 
7.46   36  64  342  851  NM_132114.1  CG14442-RA (CG14442), mRNA 
7.26   35  212  737  1513  NM_078797.2  CG13109-RA (tai), mRNA 
7.05   34  120  472  1021  NM_169386.1  CG17228-RA, transcript variant A (pros), mRNA 
6.84   33  247  739  1560  NM_139493.2  CG2083-RA (CG2083), mRNA 
6.43   31  154  449  1185  NM_168179.1  CG32394-RA (CG32394), mRNA 
6.43   31  114  444  1267  NM_176556.1  CG33106-RA, transcript variant A (mask), mRNA 
6.43   31  114  444  1267  NM_176557.1  CG33106-RB, transcript variant B (mask), mRNA 
6.22   30  274  838  1749  NM_079671.2  CG7847-RA, transcript variant A (sr), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
DC
DM
 
VM
 
VB
 
Caspase-3 signal
N
DB
++ 
DC
DM
 
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.