National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11171R-2 
 Symbol rig  Full Name rigor mortis 
 CG No CG30149  Old CG No CG11171 
 Synonyms CG30149, CG3014, l(2)05056, CG13440, CG11171, rig 
 Accession No (Link to NCBI) NM_137655.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||| silico     1   GTGGGCGACGATCTAAGCGTTCAGGTGTGGGACTGCGCATTGGGCGAAGCCGTCATCGGG 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CACAAGGCCCATCAGCACCAGCACGAGGCGCGGGATGTGCGCGTCGTGCACCACACTACC 120

                           ||||||||| ||||||||||| ||||||| |||||||||||||||||||||||||||||| silico     121 AACTCCGTGCTGATGAGCTACCTGGCCAATGGTAACATTCTATCCATGGACGCCAGTGAT 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CTGGTCATCTATTGTGTGGCATCCAACACCTACTGCCGTCGCTCCACTTTCATCTCGCCC 240

                           |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| silico     241 CGAAATCACCAACTCACTATGGTGCGCTGCTCGCCC-TACAATGACAATTTGTTCGCTGT 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GGGAACGGCTATGGGTAATGTGCTGGTCTGCGATCTGCGCAAAATGAACATCGTCTACAA 360

                           ||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||| silico     361 GTTCCACGGCCACAA-AGCGCCCATATGCGGCTTAGCCTGGCGGGAGGTGCCTGCTGCCG 420

                           |||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||| silico     421 AGGACGAAAAAACCAATAATCTGGCGTTAAGTGCTGAAGAGTGGCGAAGCCGCA-ATGGC 480

11171R-2.IR_full       481 GGCCAGGAGGAGAAACCCAAGAC 503
                           ||||||||||||||||||||||| silico     481 GGCCAGGAGGAGAAACCCAAGAC 503

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_137655.2  CG30149-RB (rig), mRNA 
0   NM_139511.2  CG1869-RA (CG1869), mRNA 
0   NM_143583.3  CG11317-RA (CG11317), mRNA 
0   NM_134714.3  CG4341-RA (CG4341), mRNA 
0   NM_168665.1  CG13035-RB, transcript variant B (CG13035), mRNA 
0   NM_140635.1  CG13035-RA, transcript variant A (CG13035), mRNA 
0   NM_142957.1  CG13605-RA (CG13605), mRNA 
0   NM_132351.1  CG1343-RA, transcript variant A (Sp1), mRNA 
0   NM_167200.1  CG1343-RB, transcript variant B (Sp1), mRNA 
0   NM_134516.2  CG32529-RA, transcript variant A (CG32529), mRNA 
0   NM_001038766.1  CG32529-RD, transcript variant D (CG32529), mRNA 
0   NM_167688.1  CG32529-RC, transcript variant C (CG32529), mRNA 
0   NM_176542.1  CG7029-RA (CG7029), mRNA 
0   NM_136443.2  CG1620-RA (CG1620), mRNA 
0   NM_143433.1  CG14506-RA (CG14506), mRNA 
0   14  NM_132403.3  CG17255-RA, transcript variant A (CG17255), mRNA 
0   14  NM_167231.3  CG17255-RB, transcript variant B (CG17255), mRNA 
0   NM_001031888.1  CG33691-RB, transcript variant B (CG33691), mRNA 
0   NM_001031885.1  CG33692-RB, transcript variant B (CG33692), mRNA 
0   NM_001031887.1  CG33691-RC, transcript variant C (CG33691), mRNA 
0   NM_001031889.1  CG33691-RA, transcript variant A (CG33691), mRNA 
0   NM_001031884.1  CG33692-RC, transcript variant C (CG33692), mRNA 
0   NM_001031886.1  CG33692-RA, transcript variant A (CG33692), mRNA 
0   NM_078974.2  CG7776-RA, transcript variant A (E(Pc)), mRNA 
0   NM_165836.1  CG7776-RB, transcript variant B (E(Pc)), mRNA 
0   NM_137191.1  CG18625-RA (CG18625), mRNA 
0   NM_165232.1  CG5674-RB, transcript variant B (CG5674), mRNA 
0   NM_136012.4  CG5674-RA, transcript variant A (CG5674), mRNA 
0   NM_165233.1  CG5674-RC, transcript variant C (CG5674), mRNA 
0   NM_057518.3  CG6358-RA (Xpac), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.