National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11171R-1 
 Symbol rig  Full Name rigor mortis 
 CG No CG30149  Old CG No CG11171 
 Synonyms CG30149, CG3014, l(2)05056, CG13440, CG11171, rig 
 Accession No (Link to NCBI) NM_137655.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGTGGGCGACGATCTAAGCGTT 
 Primer Seq. 3'
aatctagaggtaccGTCTTGGGTTTCTCCTCCTGG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GTGGGCGACG ATNTAAGCGT TCAGGTGTGG GACTGCGCAC TGGGCGAAGC CGTCATCGGG 
0061 CACAAGGCCC ATCAGCACCA GCACGAGGCG CGGGATGTGC GCGTCGTGCA CCACACTACC 
0121 AACTCCGTGG TGATGAGCTA CTTGGCCAAC GGTAACATTC TATCCATGGA CGCCAGTGAT 
0181 CTGGTCATCT ATTGTGTGGC ATCCAACACC TACTGCCGTC GCTCCACTTT CATCTCGCCC 
0241 CGAAATCACC AACTCACTAT GGTGCGCTGC TCGCCCNTAC AATGACAATT TGTTCGCTGT 
0301 GGGAACGGCT ATGGGTAATG TGCTGGTCTG CGATCTGCGC AAAATGAACA TCGTCTACAA 
0361 GTTCCACGGC CACAANAGCG CCCATATGCG GCTTGGCCTG GCGGGAGGTG CCTGCTGCCG 
0421 AGGACGAAAA AACCAATAAT CTGGCGTTGA GTGCTGAAGA GTGGCGAAgc CGCAGATGGC 
0481 GGCCAGGAGG AGAAACCCAA GAC 
 in silico PCR Fragment
0001 GTGGGCGACG ATCTAAGCGT TCAGGTGTGG GACTGCGCAT TGGGCGAAGC CGTCATCGGG 
0061 CACAAGGCCC ATCAGCACCA GCACGAGGCG CGGGATGTGC GCGTCGTGCA CCACACTACC 
0121 AACTCCGTGC TGATGAGCTA CCTGGCCAAT GGTAACATTC TATCCATGGA CGCCAGTGAT 
0181 CTGGTCATCT ATTGTGTGGC ATCCAACACC TACTGCCGTC GCTCCACTTT CATCTCGCCC 
0241 CGAAATCACC AACTCACTAT GGTGCGCTGC TCGCCC-TAC AATGACAATT TGTTCGCTGT 
0301 GGGAACGGCT ATGGGTAATG TGCTGGTCTG CGATCTGCGC AAAATGAACA TCGTCTACAA 
0361 GTTCCACGGC CACAA-AGCG CCCATATGCG GCTTAGCCTG GCGGGAGGTG CCTGCTGCCG 
0421 AGGACGAAAA AACCAATAAT CTGGCGTTAA GTGCTGAAGA GTGGCGAAGC CGCA-ATGGC 
0481 GGCCAGGAGG AGAAACCCAA GAC 
 Assemble Data

11171R-1.IR_full       1   GTGGGCGACGATNTAAGCGTTCAGGTGTGGGACTGCGCACTGGGCGAAGCCGTCATCGGG 60
                           |||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||
11171R-1.in silico     1   GTGGGCGACGATCTAAGCGTTCAGGTGTGGGACTGCGCATTGGGCGAAGCCGTCATCGGG 60


11171R-1.IR_full       61  CACAAGGCCCATCAGCACCAGCACGAGGCGCGGGATGTGCGCGTCGTGCACCACACTACC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11171R-1.in silico     61  CACAAGGCCCATCAGCACCAGCACGAGGCGCGGGATGTGCGCGTCGTGCACCACACTACC 120


11171R-1.IR_full       121 AACTCCGTGGTGATGAGCTACTTGGCCAACGGTAACATTCTATCCATGGACGCCAGTGAT 180
                           ||||||||| ||||||||||| ||||||| ||||||||||||||||||||||||||||||
11171R-1.in silico     121 AACTCCGTGCTGATGAGCTACCTGGCCAATGGTAACATTCTATCCATGGACGCCAGTGAT 180


11171R-1.IR_full       181 CTGGTCATCTATTGTGTGGCATCCAACACCTACTGCCGTCGCTCCACTTTCATCTCGCCC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11171R-1.in silico     181 CTGGTCATCTATTGTGTGGCATCCAACACCTACTGCCGTCGCTCCACTTTCATCTCGCCC 240


11171R-1.IR_full       241 CGAAATCACCAACTCACTATGGTGCGCTGCTCGCCCNTACAATGACAATTTGTTCGCTGT 300
                           |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||
11171R-1.in silico     241 CGAAATCACCAACTCACTATGGTGCGCTGCTCGCCC-TACAATGACAATTTGTTCGCTGT 300


11171R-1.IR_full       301 GGGAACGGCTATGGGTAATGTGCTGGTCTGCGATCTGCGCAAAATGAACATCGTCTACAA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11171R-1.in silico     301 GGGAACGGCTATGGGTAATGTGCTGGTCTGCGATCTGCGCAAAATGAACATCGTCTACAA 360


11171R-1.IR_full       361 GTTCCACGGCCACAANAGCGCCCATATGCGGCTTGGCCTGGCGGGAGGTGCCTGCTGCCG 420
                           ||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||
11171R-1.in silico     361 GTTCCACGGCCACAA-AGCGCCCATATGCGGCTTAGCCTGGCGGGAGGTGCCTGCTGCCG 420


11171R-1.IR_full       421 AGGACGAAAAAACCAATAATCTGGCGTTGAGTGCTGAAGAGTGGCGAAGCCGCAGATGGC 480
                           |||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||
11171R-1.in silico     421 AGGACGAAAAAACCAATAATCTGGCGTTAAGTGCTGAAGAGTGGCGAAGCCGCA-ATGGC 480


11171R-1.IR_full       481 GGCCAGGAGGAGAAACCCAAGAC 503
                           |||||||||||||||||||||||
11171R-1.in silico     481 GGCCAGGAGGAGAAACCCAAGAC 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_137655.2  CG30149-RB (rig), mRNA 
0   NM_139511.2  CG1869-RA (CG1869), mRNA 
0   NM_143583.3  CG11317-RA (CG11317), mRNA 
0   NM_134714.3  CG4341-RA (CG4341), mRNA 
0   NM_168665.1  CG13035-RB, transcript variant B (CG13035), mRNA 
0   NM_140635.1  CG13035-RA, transcript variant A (CG13035), mRNA 
0   NM_142957.1  CG13605-RA (CG13605), mRNA 
0   NM_132351.1  CG1343-RA, transcript variant A (Sp1), mRNA 
0   NM_167200.1  CG1343-RB, transcript variant B (Sp1), mRNA 
0   NM_134516.2  CG32529-RA, transcript variant A (CG32529), mRNA 
0   NM_001038766.1  CG32529-RD, transcript variant D (CG32529), mRNA 
0   NM_167688.1  CG32529-RC, transcript variant C (CG32529), mRNA 
0   NM_176542.1  CG7029-RA (CG7029), mRNA 
0   NM_136443.2  CG1620-RA (CG1620), mRNA 
0   NM_143433.1  CG14506-RA (CG14506), mRNA 
0   14  NM_132403.3  CG17255-RA, transcript variant A (CG17255), mRNA 
0   14  NM_167231.3  CG17255-RB, transcript variant B (CG17255), mRNA 
0   NM_001031888.1  CG33691-RB, transcript variant B (CG33691), mRNA 
0   NM_001031885.1  CG33692-RB, transcript variant B (CG33692), mRNA 
0   NM_001031887.1  CG33691-RC, transcript variant C (CG33691), mRNA 
0   NM_001031889.1  CG33691-RA, transcript variant A (CG33691), mRNA 
0   NM_001031884.1  CG33692-RC, transcript variant C (CG33692), mRNA 
0   NM_001031886.1  CG33692-RA, transcript variant A (CG33692), mRNA 
0   NM_078974.2  CG7776-RA, transcript variant A (E(Pc)), mRNA 
0   NM_165836.1  CG7776-RB, transcript variant B (E(Pc)), mRNA 
0   NM_137191.1  CG18625-RA (CG18625), mRNA 
0   NM_165232.1  CG5674-RB, transcript variant B (CG5674), mRNA 
0   NM_136012.4  CG5674-RA, transcript variant A (CG5674), mRNA 
0   NM_165233.1  CG5674-RC, transcript variant C (CG5674), mRNA 
0   NM_057518.3  CG6358-RA (Xpac), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.