National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11147R-2 
 Symbol CG11147  Full Name CG11147 
 CG No CG11147  Old CG No CG11147 
 Synonyms CG11147 
 Accession No (Link to NCBI) NM_135110.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees larval lethal 
 Map Viewer
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GCTGAATATGAACGTGATGCGTGGTTCTATATACGGATTGCTGGGTGCCTCCGGATGCGG 60

                           ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| silico     61  AAAGACAACCCTGCTCTCTTGCATCGTCGGCCAGAGGCGCCTCAACGGCGGCGAGGTCGT 120

                           |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| silico     121 CGTGCTTGGGGCCAAGCCAGGAGAGCCTGGTA-GCGGCGTGCCAGGATCCCGGGTGGGAT 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 TCATGCCCCAGGAGATTGCCCTGGTCGAGGAGATGACCGTCAAGGAGACAATCTTCTACT 240

                           |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| silico     241 TCGGTCGCATCTACGGCCTGACAGACGAACGCATCCGGGAGAAGTTCAAGCTGCTCAAGG 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 AGCTGCTGCAACTGCCACCGGCTAGGCAGATGATCAAGCAGTGCAGCGGTGGACAGCAGC 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GACGCTTGTCCTTCGCCTGCGCCATGATCCACGATCCGGAGCTTCTCATTCTGGACGAGC 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CCACTGTGGGATTGGATCCAATGCTGCGTGAAAAAATCTGGGACTTTCTCGTGGAGACGA 480

11147R-2.IR_full       481 CGAGGAATAGCAAATTGGCTG 501
                           ||||||||||||||||||||| silico     481 CGAGGAATAGCAAATTGGCTG 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_164658.1  CG11147-RB, transcript variant B (CG11147), mRNA 
100   482  NM_135110.1  CG11147-RA, transcript variant A (CG11147), mRNA 
0.41   NM_206068.1  CG12128-RB, transcript variant B (CG12128), mRNA 
0.41   NM_136699.3  CG12128-RA, transcript variant A (CG12128), mRNA 
0.2   NM_143499.2  CG15524-RA (CG15524), mRNA 
0.2   NM_143108.1  CG11859-RA (CG11859), mRNA 
0   NM_142601.1  CG4845-RA (CG4845), mRNA 
0   NM_143713.2  CG2173-RA (Rs1), mRNA 
0   NM_206728.1  CG9012-RD, transcript variant D (Chc), mRNA 
0   NM_206729.1  CG9012-RC, transcript variant C (Chc), mRNA 
0   NM_057694.2  CG9012-RA, transcript variant A (Chc), mRNA 
0   NM_167466.1  CG9012-RB, transcript variant B (Chc), mRNA 
0   NM_001038900.1  CG11583-RA (CG11583), mRNA 
0   NM_166920.1  CG4376-RB, transcript variant B (Actn), mRNA 
0   NM_058137.3  CG4376-RC, transcript variant C (Actn), mRNA 
0   NM_058136.3  CG4376-RA, transcript variant A (Actn), mRNA 
0   NM_144202.1  CG15213-RA (CG15213), mRNA 
0   NM_133060.1  CG6179-RA (CG6179), mRNA 
0   30  48  NM_143371.1  CG9990-RA, transcript variant A (CG9990), mRNA 
0   30  48  NM_170376.1  CG9990-RB, transcript variant B (CG9990), mRNA 
0   NM_138256.2  CG13914-RA, transcript variant A (CG13914), mRNA 
0   NM_001038896.1  CG13914-RB, transcript variant B (CG13914), mRNA 
0   NM_143522.2  CG9747-RA (CG9747), mRNA 
0   NM_167739.2  CG1801-RA (CG1801), mRNA 
0   NM_079757.3  CG5610-RA (nAcRalpha-96Aa), mRNA 
0   NM_079729.2  CG4792-RA (Dcr-1), mRNA 
0   NM_169646.2  CG6236-RB, transcript variant B (CG6236), mRNA 
0   NM_142189.3  CG6236-RA, transcript variant A (CG6236), mRNA 
0   NM_166533.1  CG6339-RA (rad50), mRNA 
0   NM_137488.2  CG12263-RA (CG12263), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.