National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11147R-1 
 Symbol CG11147  Full Name CG11147 
 CG No CG11147  Old CG No CG11147 
 Synonyms CG11147 
 Accession No (Link to NCBI) NM_135110.1 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees early pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCTGAATATGAACGTGATGCG 
 Primer Seq. 3'
aatctagaggtaccCAGCCAATTTGCTATTCCTCG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GNTGAATATG AACGTGATGC GTGGTTCTAT ATACGGATTG CTGGGTGCCT CCGGATGCGG 
0061 AAAGACAACC CTGCTCTCTT GCATCGTCGG CCAGAGGCgC CNCAACGGCG GCGAGGTCGT 
0121 CGTGCTTGGG GCCAAGCCAG GAGAGCCTGG TANGCGGCGT GCCAGGATCC CGGGTGGGAT 
0181 TCATGCCCCA GGAGATTGCC CTGGTCGAGG AGATGACCGT CAAGGAGACA ATCTTCTACT 
0241 TCGGTCGCAT CTACGGCCTG ACAGACGAAC GCATCCGGGA AAAGTTCAAG CTGCTCAAGG 
0301 AGCTGCTGCA ACTGCCACCG GCTAGGCAGA TGATCAAGCA GTGCAGCGGT GGACAGCANN 
0361 GACGCTTGTC CTTCgCCTGC GCCATGATCC ACGATCCGGA GCTTCTCATT CTGGACGAGC 
0421 CCACTGTGGG ATTGGATCCA ATGCTGCGTG AAAAAATCTG GGACTTTCTC GTGGAGACGA 
0481 CGAGGAATAG CAAATTGGCT G 
 in silico PCR Fragment
0001 GCTGAATATG AACGTGATGC GTGGTTCTAT ATACGGATTG CTGGGTGCCT CCGGATGCGG 
0061 AAAGACAACC CTGCTCTCTT GCATCGTCGG CCAGAGGCGC CTCAACGGCG GCGAGGTCGT 
0121 CGTGCTTGGG GCCAAGCCAG GAGAGCCTGG TA-GCGGCGT GCCAGGATCC CGGGTGGGAT 
0181 TCATGCCCCA GGAGATTGCC CTGGTCGAGG AGATGACCGT CAAGGAGACA ATCTTCTACT 
0241 TCGGTCGCAT CTACGGCCTG ACAGACGAAC GCATCCGGGA GAAGTTCAAG CTGCTCAAGG 
0301 AGCTGCTGCA ACTGCCACCG GCTAGGCAGA TGATCAAGCA GTGCAGCGGT GGACAGCAGC 
0361 GACGCTTGTC CTTCGCCTGC GCCATGATCC ACGATCCGGA GCTTCTCATT CTGGACGAGC 
0421 CCACTGTGGG ATTGGATCCA ATGCTGCGTG AAAAAATCTG GGACTTTCTC GTGGAGACGA 
0481 CGAGGAATAG CAAATTGGCT G 
 Assemble Data

11147R-1.IR_full       1   GNTGAATATGAACGTGATGCGTGGTTCTATATACGGATTGCTGGGTGCCTCCGGATGCGG 60
                           | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11147R-1.in silico     1   GCTGAATATGAACGTGATGCGTGGTTCTATATACGGATTGCTGGGTGCCTCCGGATGCGG 60


11147R-1.IR_full       61  AAAGACAACCCTGCTCTCTTGCATCGTCGGCCAGAGGCGCCNCAACGGCGGCGAGGTCGT 120
                           ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
11147R-1.in silico     61  AAAGACAACCCTGCTCTCTTGCATCGTCGGCCAGAGGCGCCTCAACGGCGGCGAGGTCGT 120


11147R-1.IR_full       121 CGTGCTTGGGGCCAAGCCAGGAGAGCCTGGTANGCGGCGTGCCAGGATCCCGGGTGGGAT 180
                           |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
11147R-1.in silico     121 CGTGCTTGGGGCCAAGCCAGGAGAGCCTGGTA-GCGGCGTGCCAGGATCCCGGGTGGGAT 180


11147R-1.IR_full       181 TCATGCCCCAGGAGATTGCCCTGGTCGAGGAGATGACCGTCAAGGAGACAATCTTCTACT 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11147R-1.in silico     181 TCATGCCCCAGGAGATTGCCCTGGTCGAGGAGATGACCGTCAAGGAGACAATCTTCTACT 240


11147R-1.IR_full       241 TCGGTCGCATCTACGGCCTGACAGACGAACGCATCCGGGAAAAGTTCAAGCTGCTCAAGG 300
                           |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
11147R-1.in silico     241 TCGGTCGCATCTACGGCCTGACAGACGAACGCATCCGGGAGAAGTTCAAGCTGCTCAAGG 300


11147R-1.IR_full       301 AGCTGCTGCAACTGCCACCGGCTAGGCAGATGATCAAGCAGTGCAGCGGTGGACAGCANN 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  
11147R-1.in silico     301 AGCTGCTGCAACTGCCACCGGCTAGGCAGATGATCAAGCAGTGCAGCGGTGGACAGCAGC 360


11147R-1.IR_full       361 GACGCTTGTCCTTCGCCTGCGCCATGATCCACGATCCGGAGCTTCTCATTCTGGACGAGC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11147R-1.in silico     361 GACGCTTGTCCTTCGCCTGCGCCATGATCCACGATCCGGAGCTTCTCATTCTGGACGAGC 420


11147R-1.IR_full       421 CCACTGTGGGATTGGATCCAATGCTGCGTGAAAAAATCTGGGACTTTCTCGTGGAGACGA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11147R-1.in silico     421 CCACTGTGGGATTGGATCCAATGCTGCGTGAAAAAATCTGGGACTTTCTCGTGGAGACGA 480


11147R-1.IR_full       481 CGAGGAATAGCAAATTGGCTG 501
                           |||||||||||||||||||||
11147R-1.in silico     481 CGAGGAATAGCAAATTGGCTG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_164658.1  CG11147-RB, transcript variant B (CG11147), mRNA 
100   482  NM_135110.1  CG11147-RA, transcript variant A (CG11147), mRNA 
0.41   NM_206068.1  CG12128-RB, transcript variant B (CG12128), mRNA 
0.41   NM_136699.3  CG12128-RA, transcript variant A (CG12128), mRNA 
0.2   NM_143499.2  CG15524-RA (CG15524), mRNA 
0.2   NM_143108.1  CG11859-RA (CG11859), mRNA 
0   NM_142601.1  CG4845-RA (CG4845), mRNA 
0   NM_143713.2  CG2173-RA (Rs1), mRNA 
0   NM_206728.1  CG9012-RD, transcript variant D (Chc), mRNA 
0   NM_206729.1  CG9012-RC, transcript variant C (Chc), mRNA 
0   NM_057694.2  CG9012-RA, transcript variant A (Chc), mRNA 
0   NM_167466.1  CG9012-RB, transcript variant B (Chc), mRNA 
0   NM_001038900.1  CG11583-RA (CG11583), mRNA 
0   NM_166920.1  CG4376-RB, transcript variant B (Actn), mRNA 
0   NM_058137.3  CG4376-RC, transcript variant C (Actn), mRNA 
0   NM_058136.3  CG4376-RA, transcript variant A (Actn), mRNA 
0   NM_144202.1  CG15213-RA (CG15213), mRNA 
0   NM_133060.1  CG6179-RA (CG6179), mRNA 
0   30  48  NM_143371.1  CG9990-RA, transcript variant A (CG9990), mRNA 
0   30  48  NM_170376.1  CG9990-RB, transcript variant B (CG9990), mRNA 
0   NM_138256.2  CG13914-RA, transcript variant A (CG13914), mRNA 
0   NM_001038896.1  CG13914-RB, transcript variant B (CG13914), mRNA 
0   NM_143522.2  CG9747-RA (CG9747), mRNA 
0   NM_167739.2  CG1801-RA (CG1801), mRNA 
0   NM_079757.3  CG5610-RA (nAcRalpha-96Aa), mRNA 
0   NM_079729.2  CG4792-RA (Dcr-1), mRNA 
0   NM_169646.2  CG6236-RB, transcript variant B (CG6236), mRNA 
0   NM_142189.3  CG6236-RA, transcript variant A (CG6236), mRNA 
0   NM_166533.1  CG6339-RA (rad50), mRNA 
0   NM_137488.2  CG12263-RA (CG12263), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
 
DM
 
VM
 
VB
 
Caspase-3 signal
N
 
DB
 
DC
 
DM
 
VM
 
VB
 
Dcompartment   Penetrance
   

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.