National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11143R-1 
 Symbol Inos  Full Name Inos 
 CG No CG11143  Old CG No CG11143 
 Synonyms CG11143, bs36h12.y1, INOS, Inos 
 Accession No (Link to NCBI) NM_058057.4 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGCCCACCAATAACTCAACCC 
 Primer Seq. 3'
aatctagaggtaccGATCTGATCCTGCAGAGCCAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AGCCCACCAA TAACTCAACC CTGGAGGTAA TCTCGCCGAA AGTGCAGGTG GACGATGAGT 
0061 TCATCACCAC CGACTACGAT TACCAGACAT CCCATGTGAA GCGCACCGCC GATGGACAGC 
0121 TCCAGGTGCA CCCCCAGACG ACGTCGCTGA AGATACGGAC GGGTCGCCAT GTGCCCAAGC 
0181 TGGGCGTGNA TGCNTGGTGG GATGGGGTGG CAACAACGGA TCCACGCTGA CCGCCGCCCT 
0241 GGAGGCCAAT CGTCGCCAGC TGAAGTGGCG CANAGCGGAC GGGCGTCCAG GAGGCCAACT 
0301 GGTATGGTTC CATTACACAG GCGTCCACCG TCTTCATTGG ATCCGATGAG GACGGCGGTG 
0361 ACGTGTACGT GCCCATGAAG GAGCTGCTGC CCATGGTGGA GCCCGACAAC ATTATCGTGG 
0421 ATGGCTGGGA TATCAGTGGC CTGCATTTGG GCGACGCCAT GCGCAGGGCC GAGGTCCTAG 
0481 ACGTGGCTCT GCAGGATCAG ATC 
 in silico PCR Fragment
0001 AGCCCACCAA TAACTCAACC CTGGAGGTAA TCTCGCCGAA AGTGCAGGTG GACGATGAGT 
0061 TCATCACCAC CGACTACGAT TACCAGACAT CCCATGTGAA GCGCACCGCC GATGGACAGC 
0121 TCCAGGTGCA CCCCCAGACG ACGTCGCTGA AGATACGGAC GGGTCGCCAT GTGCCCAAGC 
0181 TGGGCGTG-A TGC-TGGTGG GATGGGGTGG CAACAACGGA TCCACGCTGA CCGCCGCCCT 
0241 GGAGGCCAAT CGTCGCCAGC TGAAGTGGCG CA-AGCGGAC GGGCGTCCAG GAGGCCAACT 
0301 GGTATGGTTC CATTACACAG GCGTCCACCG TCTTCATTGG ATCCGATGAG GACGGCGGTG 
0361 ACGTGTACGT GCCCATGAAG GAGCTGCTGC CCATGGTGGA GCCCGACAAC ATTATCGTGG 
0421 ATGGCTGGGA TATCAGTGGC CTGCATTTGG GCGACGCCAT GCGCAGGGCC GAGGTCCTAG 
0481 ACGTGGCTCT GCAGGATCAG ATC 
 Assemble Data

11143R-1.IR_full       1   AGCCCACCAATAACTCAACCCTGGAGGTAATCTCGCCGAAAGTGCAGGTGGACGATGAGT 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11143R-1.in silico     1   AGCCCACCAATAACTCAACCCTGGAGGTAATCTCGCCGAAAGTGCAGGTGGACGATGAGT 60


11143R-1.IR_full       61  TCATCACCACCGACTACGATTACCAGACATCCCATGTGAAGCGCACCGCCGATGGACAGC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11143R-1.in silico     61  TCATCACCACCGACTACGATTACCAGACATCCCATGTGAAGCGCACCGCCGATGGACAGC 120


11143R-1.IR_full       121 TCCAGGTGCACCCCCAGACGACGTCGCTGAAGATACGGACGGGTCGCCATGTGCCCAAGC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11143R-1.in silico     121 TCCAGGTGCACCCCCAGACGACGTCGCTGAAGATACGGACGGGTCGCCATGTGCCCAAGC 180


11143R-1.IR_full       181 TGGGCGTGNATGCNTGGTGGGATGGGGTGGCAACAACGGATCCACGCTGACCGCCGCCCT 240
                           |||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||
11143R-1.in silico     181 TGGGCGTG-ATGC-TGGTGGGATGGGGTGGCAACAACGGATCCACGCTGACCGCCGCCCT 240


11143R-1.IR_full       241 GGAGGCCAATCGTCGCCAGCTGAAGTGGCGCANAGCGGACGGGCGTCCAGGAGGCCAACT 300
                           |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
11143R-1.in silico     241 GGAGGCCAATCGTCGCCAGCTGAAGTGGCGCA-AGCGGACGGGCGTCCAGGAGGCCAACT 300


11143R-1.IR_full       301 GGTATGGTTCCATTACACAGGCGTCCACCGTCTTCATTGGATCCGATGAGGACGGCGGTG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11143R-1.in silico     301 GGTATGGTTCCATTACACAGGCGTCCACCGTCTTCATTGGATCCGATGAGGACGGCGGTG 360


11143R-1.IR_full       361 ACGTGTACGTGCCCATGAAGGAGCTGCTGCCCATGGTGGAGCCCGACAACATTATCGTGG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11143R-1.in silico     361 ACGTGTACGTGCCCATGAAGGAGCTGCTGCCCATGGTGGAGCCCGACAACATTATCGTGG 420


11143R-1.IR_full       421 ATGGCTGGGATATCAGTGGCCTGCATTTGGGCGACGCCATGCGCAGGGCCGAGGTCCTAG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11143R-1.in silico     421 ATGGCTGGGATATCAGTGGCCTGCATTTGGGCGACGCCATGCGCAGGGCCGAGGTCCTAG 480


11143R-1.IR_full       481 ACGTGGCTCTGCAGGATCAGATC 503
                           |||||||||||||||||||||||
11143R-1.in silico     481 ACGTGGCTCTGCAGGATCAGATC 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  17  NM_058057.4  CG11143-RA (Inos), mRNA 
0.41   NM_142140.1  CG17304-RA (CG17304), mRNA 
0.2   NM_001042877.1  CG13778-RC, transcript variant C (Mnn1), mRNA 
0.2   NM_078774.3  CG13778-RA, transcript variant A (Mnn1), mRNA 
0   NM_001014591.1  CG8103-RB, transcript variant B (Mi-2), mRNA 
0   NM_140897.2  CG8103-RA, transcript variant A (Mi-2), mRNA 
0   NM_079730.2  CG6669-RA (klg), mRNA 
0   NM_140236.2  CG7334-RA, transcript variant A (Sug), mRNA 
0   NM_206335.1  CG7334-RB, transcript variant B (Sug), mRNA 
0   NM_135430.2  CG12439-RA (CG12439), mRNA 
0   NM_057302.2  CG10250-RA (nau), mRNA 
0   NM_058135.2  CG10917-RA (fj), mRNA 
0   NM_132207.2  CG1571-RA (CG1571), mRNA 
0   NM_137948.1  CG3520-RA (CG3520), mRNA 
0   NM_139594.1  CG11593-RA (CG11593), mRNA 
0   NM_142495.1  CG14299-RA, transcript variant A (CG14299), mRNA 
0   NM_001014640.1  CG14299-RB, transcript variant B (CG14299), mRNA 
0   NM_133027.1  CG12985-RA (CG12985), mRNA 
0   12  NM_136670.2  CG1776-RA (CG1776), mRNA 
0   NM_170466.1  CG31025-RA, transcript variant A (CG31025), mRNA 
0   NM_170467.1  CG31025-RB, transcript variant B (CG31025), mRNA 
0   NM_134478.1  CG14219-RA (CG14219), mRNA 
0   NM_139495.1  CG9973-RA (CG9973), mRNA 
0   NM_135752.2  CG12404-RA (CG12404), mRNA 
0   NM_135641.2  CG4705-RA, transcript variant A (CG4705), mRNA 
0   NM_078980.2  CG8972-RA (rho-7), mRNA 
0   NM_205960.1  CG4705-RB, transcript variant B (CG4705), mRNA 
0   NM_138044.2  CG13569-RA, transcript variant A (CG13569), mRNA 
0   NM_166663.1  CG13569-RB, transcript variant B (CG13569), mRNA 
0   NM_133125.2  CG7537-RB (inx5), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.