National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11136R-3 
 Symbol CG11136  Full Name CG11136 
 CG No CG11136  Old CG No CG11136 
 Synonyms tartan/capricious-like, CT31131, CG11136 
 Accession No (Link to NCBI) NM_137662.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| silico     1   CTCGAGTGCGGATGCGAT-CTGCCTCACACACTTCGATGCAACATTGATCTGCACGGGAT 60

                           || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GA-TGCTCCTGGCGGATCGACTACGCACTTCTCCCTACTCCATATCATTGCTGGACTGTT 120

                           || |||||||||||||||||||  |||||||||||||||||||||||||||||||||||| silico     121 CCTTGCGCAACGTGACCTTCCT-GAGCGACGCGAAGATCTTCGACAATGTCTCGCTCCAC 180

                           ||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||| silico     181 GGACTAGTAATCTCGTCCGGAGAGATCAAGCGGGTACACAAGTCCGCC-TTCCTGGGCAT 240

                           ||||||||||||||| |||||||||||||| || ||||||||||||||||| |||||||| silico     241 TCGAGGACCGCTGCAAGCACTCGGTCTGCCCGGGAACGCACTGATGAGCGTGCCCTGGAA 300

                           ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| silico     301 CGCCCTGTCCACGCTGAGCGCCT-TGGAGCGCTTGGATCTGGCCAATAACAAGATCAAGG 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CTCTGGGAACGGCGGACTTTGTGGGATTGACTAGCTTGGTTTATCTGGAGCTGAGCAACA 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 ATCAAATCTCTAGCATATCCCAACGCACGTTTGTTAATCTTCGAAAGCTGGAGGTGCTGA 480

11136R-3.IR_full       481 AGCTGGGCGGGAATCGATTGGGTGA 505
                           ||||||||||||||||||||||||| silico     481 AGCTGGGCGGGAATCGATTGGGTGA 505

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_137662.1  CG11136-RA (CG11136), mRNA 
0   NM_138093.2  CG4681-RA (CG4681), mRNA 
0   NM_130481.2  CG13375-RA (CG13375), mRNA 
0   NM_135264.1  CG4969-RA (Wnt6), mRNA 
0   NM_135340.2  CG8668-RA (CG8668), mRNA 
0   NM_137628.1  CG13868-RA (CG13868), mRNA 
0   NM_168811.1  CG32209-RB (CG32209), mRNA 
0   NM_057737.2  CG15804-RA, transcript variant A (Dhc62B), mRNA 
0   NM_206236.1  CG15804-RB, transcript variant B (Dhc62B), mRNA 
0   NM_136472.3  CG1399-RB, transcript variant B (CG1399), mRNA 
0   NM_142046.1  CG9591-RA (omd), mRNA 
0   NM_166546.2  CG30092-RD, transcript variant D (jbug), mRNA 
0   NM_141545.2  CG11732-RA (Obp85a), mRNA 
0   NM_058125.3  CG1341-RA (Rpt1), mRNA 
0   NM_170222.1  CG10618-RA (CHKov1), mRNA 
0   NM_169512.1  CG9813-RF, transcript variant F (CG9813), mRNA 
0   NM_169516.1  CG9813-RE, transcript variant E (CG9813), mRNA 
0   NM_169511.1  CG9813-RC, transcript variant C (CG9813), mRNA 
0   NM_169515.1  CG9813-RD, transcript variant D (CG9813), mRNA 
0   NM_169514.1  CG9813-RB, transcript variant B (CG9813), mRNA 
0   NM_169513.1  CG9813-RA, transcript variant A (CG9813), mRNA 
0   NM_206101.1  CG13168-RC, transcript variant C (CG13168), mRNA 
0   NM_206100.1  CG13168-RB, transcript variant B (CG13168), mRNA 
0   NM_132722.2  CG1434-RA (CG1434), mRNA 
0   NM_142838.3  CG31152-RA (CG31152), mRNA 
0   20  NM_143497.2  CG7896-RA (CG7896), mRNA 
0   10  NM_165089.2  CG3479-RA, transcript variant A (osp), mRNA 
0   10  NM_078843.4  CG3479-RB, transcript variant B (osp), mRNA 
0   NM_079331.2  CG11280-RA (trn), mRNA 
0   NM_132035.1  CG4064-RA (CG4064), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.