National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11123R-3 
 Symbol CG11123  Full Name CG11123 
 CG No CG11123  Old CG No CG11123 
 Synonyms CG11123 
 Accession No (Link to NCBI) NM_136432.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.<br> A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.<br> PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.<br> RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.<br> Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

11123R-3.IR_full       1   CCAAGAAGAAGGGCAACC<span class="snp"><tt>N</tt></span>CTTTATGCGGAACG<span class="snp"><tt>C</tt></span>CCAAGGGGTTCGCCAAGCAGGGGATA 60
                           ||||||||||||||||||<span class="snp"><tt>&nbsp;</tt></span>||||||||||||||<span class="snp"><tt>&nbsp;</tt></span>|||||||||||||||||||||||||| silico     1   CCAAGAAGAAGGGCAACC<span class="snp"><tt>G</tt></span>CTTTATGCGGAACG<span class="snp"><tt>-</tt></span>CCAAGGGGTTCGCCAAGCAGGGGATA 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  TTCGGCCGGGGTACGCACATCGACGACGAGCAGTTCAACTACTTCATCAACATTCTGGAT 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GCTATGAAAGTGGGATTCGAGGACGTAGAGGAGCGAGTCATCATGGCCAACAATGTGTTC 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GAGCAGACCCACGATCAGGAGATCCATCTGGCCTCCAATCAGATCGTGTCCAAGGCTCTG 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GAGTCGTTAGTGGGCTTCGTGGACGACGTGCAGTTGGAGCGCTTTTTTAGCAAGTTTGGC 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GACAACCTCCGGCCCATGTGCTCCGATCGGTTTGCCTCGCACGTCCTGCAGAAAATGCTG 360

11123R-3.IR_full       361 GAAATCGCCTTTTTGCGCGGAGTGGGAAAATCTGCAGCCCAGGATACCAGCGATGC<span class="snp"><tt>N</tt></span>G<span class="snp"><tt>N</tt></span>T 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||<span class="snp"><tt>&nbsp;</tt></span>|<span class="snp"><tt>&nbsp;</tt></span>| silico     361 GAAATCGCCTTTTTGCGCGGAGTGGGAAAATCTGCAGCCCAGGATACCAGCGATGC<span class="snp"><tt>A</tt></span>G<span class="snp"><tt>C</tt></span>T 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 AGCGCCAACAAAAAAGCTAAGCCGGATGCCGCTCAAGAGGAGGAGGAGTACAACCTGCAG 480

11123R-3.IR_full       481 GCGGACTTCACAGATGATCAC 501
                           ||||||||||||||||||||| silico     481 GCGGACTTCACAGATGATCAC 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_136432.1  CG11123-RA (CG11123), mRNA 
0.2   NM_176103.1  CG14764-RA (CG14764), mRNA 
0   NM_135222.2  CG11188-RA (CG11188), mRNA 
0   NM_137252.2  CG8445-RA, transcript variant A (CG8445), mRNA 
0   NM_176194.1  CG8445-RB, transcript variant B (CG8445), mRNA 
0   NM_001038789.1  CG34011-RA (CG34011), mRNA 
0   NM_139448.2  CG32300-RB (oxt), mRNA 
0   NM_138025.2  CG3121-RA (CG3121), mRNA 
0   NM_143526.1  CG9737-RA (CG9737), mRNA 
0   NM_140119.2  CG6685-RA (CG6685), mRNA 
0   NM_079393.2  CG4083-RA (Mo25), mRNA 
0   NM_079617.3  CG7855-RA (timeout), mRNA 
0   NM_140889.1  CG14101-RA (CG14101), mRNA 
0   NM_140029.2  CG4942-RA (CG4942), mRNA 
0   NM_206212.1  CG3318-RB, transcript variant B (Dat), mRNA 
0   NM_136985.2  CG13320-RA, transcript variant A (Sans), mRNA 
0   NM_176160.1  CG13320-RB, transcript variant B (Sans), mRNA 
0   NM_057796.2  CG10379-RA (mbc), mRNA 
0   NM_167891.2  CG32313-RA (CG32313), mRNA 
0   NM_166546.2  CG30092-RD, transcript variant D (jbug), mRNA 
0   NM_139450.2  CG5714-RA (ecd), mRNA 
0   NM_141568.2  CG9797-RA (CG9797), mRNA 
0   NM_001014610.1  CG33546-RB, transcript variant B (gfzf), mRNA 
0   NM_001014609.1  CG33546-RC, transcript variant C (gfzf), mRNA 
0   12  NM_001014571.1  CG33556-RA (form3), mRNA 
0   NM_132622.1  CG18646-RA (CG18646), mRNA 
0   NM_142992.1  CG6454-RB, transcript variant B (CG6454), mRNA 
0   NM_139356.1  CG3524-RA (v(2)k05816), mRNA 
0   NM_132186.1  CG10932-RA (CG10932), mRNA 
0   NM_001014461.1  CG9967-RB, transcript variant B (CG9967), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance
 Pathways (updated: 2024/04/26)
 KEGG Pathway

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.