National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11098R-3 
 Symbol Tango1  Full Name Transport and Golgi organization 1 
 CG No CG11098  Old CG No CG11098 
 Synonyms CG11098, TANGO1, Tango1 
 Accession No (Link to NCBI) NM_135214.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Liu M, Feng Z, Ke H, Liu Y, Sun T, Dai J, Cui W, Pastor-Pareja JC.
Tango1 spatially organizes ER exit sites to control ER export.
J. Cell Biol. (2017) 216(4) 1035-1049 [ PubMed ID = 28280122 ] [ RRC reference ]

Ríos-Barrera LD, Sigurbjörnsdóttir S, Baer M, Leptin M.
Dual function for Tango1 in secretion of bulky cargo and in ER-Golgi morphology.
Proc. Natl. Acad. Sci. U.S.A. (2017) 114(48) E10389-E10398 [ PubMed ID = 29138315 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCACCTACGCCATTGGTGGTGA 
 Primer Seq. 3'
aatctagaggtaccGGTCTGCTGCCGTCTCTGGAA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CACCTACGCC ATTGGTGGTG AGGGGCTGAT ATCCTTCAAA ATCAACTCCC CCATCCGCGT 
0061 CCTGTCCAAG AGCGCCGGTT CCAATATGCA ACTGTGGGGT GTGGACATCA ATGGGCGGCG 
0121 CgGCNTATGC CAATAAGGAC TTTATCATGG AAAAGAAGAT CCTCGTCCGG GATAAGGATC 
0181 TATTGTACGA GGTGCCAGTG GTGGGACCTG GTAGTCCAGT GCAGTCAGTG GAGACACCAG 
0241 TTCAGAGCGT CGAGACGACA GTGCAGCCTG TTCTTAACGC CTCTGAGTCA ACCGATGATC 
0301 TGGCAACGAC TACAACGTCA CCACTTGAGA TAGCCGTTGA TTCAATAGTG GTTGAGCACG 
0361 ACAAGCTGCA GGATCAGCAG GTTCCTGATC CTACTGCGGC TTCCAAGGCC CAAGTGCAGG 
0421 TTATAGAAGG AACTGAGCTT CCCCTGGAGG CCATTGCAGC TACAACGGAA GGTAGCATTG 
0481 TTCCAGAGAC GGCAGCAGAC C 
 in silico PCR Fragment
0001 CACCTACGCC ATTGGTGGTG AGGGGCTGAT ATCCTTCAAA ATCAACTCCC CCATCCGCGT 
0061 CCTGTCCAAG AGCGCCGGTT CCAATATGCA ACTGTGGGGT GTGGACATCA ATGGGCGGCG 
0121 CGGC-TATGC CAATAAGGAC TTTATCATGG AAAAGAAGAT CCTCGTCCGG GATAAGGATC 
0181 TATTGTACGA GGTGCCAGTG GTGGGACCTG GTAGTCCAGT GCAGTCAGTG GAGACACCAG 
0241 TTCAGAGCGT CGAGACGACA GTGCAGCCTG TTCTTAACGC CTCTGAGTCA ACCGATGATC 
0301 TGGCAACGAC TACAACGTCA CCACTTGAGA TAGCCGTTGA TTCAATAGTG GTTGAGCACG 
0361 ACAAGCTGCA GGATCAGCAG GTTCCTGATC CTACTGCGGC TTCCAAGGCC CAAGTGCAGG 
0421 TTATAGAAGG AACTGAGCTT CCCCTGGAGG CCATTGCAGC TACAACGGAA GGTAGCATTG 
0481 TTCCAGAGAC GGCAGCAGAC C 
 Assemble Data

11098R-3.IR_full       1   CACCTACGCCATTGGTGGTGAGGGGCTGATATCCTTCAAAATCAACTCCCCCATCCGCGT 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11098R-3.in silico     1   CACCTACGCCATTGGTGGTGAGGGGCTGATATCCTTCAAAATCAACTCCCCCATCCGCGT 60


11098R-3.IR_full       61  CCTGTCCAAGAGCGCCGGTTCCAATATGCAACTGTGGGGTGTGGACATCAATGGGCGGCG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11098R-3.in silico     61  CCTGTCCAAGAGCGCCGGTTCCAATATGCAACTGTGGGGTGTGGACATCAATGGGCGGCG 120


11098R-3.IR_full       121 CGGCNTATGCCAATAAGGACTTTATCATGGAAAAGAAGATCCTCGTCCGGGATAAGGATC 180
                           |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
11098R-3.in silico     121 CGGC-TATGCCAATAAGGACTTTATCATGGAAAAGAAGATCCTCGTCCGGGATAAGGATC 180


11098R-3.IR_full       181 TATTGTACGAGGTGCCAGTGGTGGGACCTGGTAGTCCAGTGCAGTCAGTGGAGACACCAG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11098R-3.in silico     181 TATTGTACGAGGTGCCAGTGGTGGGACCTGGTAGTCCAGTGCAGTCAGTGGAGACACCAG 240


11098R-3.IR_full       241 TTCAGAGCGTCGAGACGACAGTGCAGCCTGTTCTTAACGCCTCTGAGTCAACCGATGATC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11098R-3.in silico     241 TTCAGAGCGTCGAGACGACAGTGCAGCCTGTTCTTAACGCCTCTGAGTCAACCGATGATC 300


11098R-3.IR_full       301 TGGCAACGACTACAACGTCACCACTTGAGATAGCCGTTGATTCAATAGTGGTTGAGCACG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11098R-3.in silico     301 TGGCAACGACTACAACGTCACCACTTGAGATAGCCGTTGATTCAATAGTGGTTGAGCACG 360


11098R-3.IR_full       361 ACAAGCTGCAGGATCAGCAGGTTCCTGATCCTACTGCGGCTTCCAAGGCCCAAGTGCAGG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11098R-3.in silico     361 ACAAGCTGCAGGATCAGCAGGTTCCTGATCCTACTGCGGCTTCCAAGGCCCAAGTGCAGG 420


11098R-3.IR_full       421 TTATAGAAGGAACTGAGCTTCCCCTGGAGGCCATTGCAGCTACAACGGAAGGTAGCATTG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11098R-3.in silico     421 TTATAGAAGGAACTGAGCTTCCCCTGGAGGCCATTGCAGCTACAACGGAAGGTAGCATTG 480


11098R-3.IR_full       481 TTCCAGAGACGGCAGCAGACC 501
                           |||||||||||||||||||||
11098R-3.in silico     481 TTCCAGAGACGGCAGCAGACC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135214.2  CG11098-RA, transcript variant A (Tango1), mRNA 
100   482  NM_164697.1  CG11098-RB, transcript variant B (Tango1), mRNA 
0.2   NM_078945.2  CG2346-RA (Fmrf), mRNA 
0   NM_078907.2  CG10106-RA (Tsp42Ee), mRNA 
0   NM_138050.2  CG3363-RA (CG3363), mRNA 
0   NM_176734.1  CG33206-RA, transcript variant A (l(1)G0168), mRNA 
0   NM_176735.1  CG33206-RB, transcript variant B (l(1)G0168), mRNA 
0   NM_206604.1  CG3051-RC, transcript variant C (SNF1A), mRNA 
0   NM_057965.3  CG3051-RA, transcript variant A (SNF1A), mRNA 
0   NM_166880.1  CG3051-RB, transcript variant B (SNF1A), mRNA 
0   NM_164382.1  CG3935-RA (al), mRNA 
0   NM_079953.3  CG10776-RA (wit), mRNA 
0   NM_167340.1  CG32648-RA (Pde9), mRNA 
0   NM_079619.2  CG9829-RA (poly), mRNA 
0   NM_132125.1  CG4536-RA (CG4536), mRNA 
0   NM_205879.1  CG11148-RB, transcript variant B (CG11148), mRNA 
0   NM_143693.2  CG11148-RA, transcript variant A (CG11148), mRNA 
0   NM_205878.1  CG11148-RC, transcript variant C (CG11148), mRNA 
0   NM_079503.2  CG9761-RA (Nep2), mRNA 
0   NM_170143.1  CG17780-RB, transcript variant B (CG17780), mRNA 
0   NM_143002.1  CG17780-RA, transcript variant A (CG17780), mRNA 
0   13  NM_057269.2  CG10236-RA (LanA), mRNA 
0   11  NM_139443.1  CG13809-RA (osm-1), mRNA 
0   10  NM_136192.2  CG2508-RA (cdc23), mRNA 
0   10  NM_165331.2  CG31687-RA (CG31687), mRNA 
0   NM_169683.1  CG31291-RA, transcript variant A (CG31291), mRNA 
0   NM_169682.1  CG31291-RB, transcript variant B (CG31291), mRNA 
0   NM_168667.1  CG32159-RB (CG32159), mRNA 
0   NM_140097.1  CG6749-RA (CG6749), mRNA 
0   NM_206711.1  CG33249-RA (CG33249), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.