National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11081R-2 
 Symbol plexA  Full Name plexin A 
 CG No CG11081  Old CG No CG11081 
 Synonyms PlexA1, PlexA, Plex1, CG11081, DPlexA, D-Plex A, BcDNA:GM05237, plexA 
 Accession No (Link to NCBI) NM_079898.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CGAGGACAGGTTGTCAAACCCTGGCAGCAAATATATGGTCTGACAAGACGACTGCGCAAA 60

                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| silico     61  ATGAGCCGATAAATTTGACTAATGCAAATGCACCGATAAAGAATGCAAAGAATCTGAATT 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CTACGATTACAAATGTAGCTGCGTTTGACACCAAATTGAATCACCTATTAGTGGACACCA 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 TTACTGGACGAGTCTTCGTTGGTGGTGTTAACAGGTTGTATCAGTTGTCGCCTGATTTGG 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 AGCTTTCCGAAACTGTGAAAACGGGGCCTCAAAATGATTCCGTCGAGTGTAGCATTCTTG 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 ATTGTCCATTAAATGCAGTTCGCAGTCCGACGGACAATTATAATAAGGTCTTGCTCATTG 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 ATCGTGCAACTTCAAGACTTATTGCGTGTGGATCACTATTTCAAGGTACATGCACAGTTC 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GTAATCTTCAAAATGTCAGCATAATTGAGCATGAAGTTCCTGATGCTGTTGTGGCTAATG 480

11081R-2.IR_full       481 ATGCCAACTCCTCAACCGTA 500
                           |||||||||||||||||||| silico     481 ATGCCAACTCCTCAACCGTA 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079898.2  CG11081-RA, transcript variant A (plexA), mRNA 
100   482  NM_166806.2  CG11081-RD, transcript variant D (plexA), mRNA 
100   482  NM_001038715.1  CG11081-RE, transcript variant E (plexA), mRNA 
0   NM_080165.1  CG18211-RA (betaTry), mRNA 
0   NM_137730.2  CG30387-RA, transcript variant A (CG30387), mRNA 
0   NM_170563.1  CG1815-RB, transcript variant B (CG1815), mRNA 
0   NM_143624.2  CG1815-RC, transcript variant C (CG1815), mRNA 
0   NM_170562.1  CG1815-RA, transcript variant A (CG1815), mRNA 
0   NM_137248.2  CG8435-RA (CG8435), mRNA 
0   NM_142062.1  CG14363-RA (CG14363), mRNA 
0   NM_001014610.1  CG33546-RB, transcript variant B (gfzf), mRNA 
0   NM_169935.1  CG31191-RA (CG31191), mRNA 
0   NM_078509.2  CG3929-RA (dx), mRNA 
0   NM_142524.2  CG6040-RA (CG6040), mRNA 
0   NM_140114.1  CG14164-RA (CG14164), mRNA 
0   10  NM_166428.2  CG30389-RB, transcript variant B (CG30389), mRNA 
0   10  NM_137712.3  CG30389-RC, transcript variant C (CG30389), mRNA 
0   10  NM_137711.3  CG30389-RA, transcript variant A (CG30389), mRNA 
0   NM_137474.3  CG15066-RA (IM23), mRNA 
0   NM_138190.1  CG1233-RB, transcript variant B (CG1233), mRNA 
0   NM_167833.1  CG1233-RA, transcript variant A (CG1233), mRNA 
0   NM_079869.2  CG1528-RA, transcript variant A (gammaCop), mRNA 
0   NM_170553.1  CG1528-RB, transcript variant B (gammaCop), mRNA 
0   NM_166289.1  CG5186-RB, transcript variant B (slim), mRNA 
0   NM_079058.2  CG5186-RA, transcript variant A (slim), mRNA 
0   11  NM_168837.1  CG17233-RC, transcript variant C (CG17233), mRNA 
0   11  NM_140939.2  CG17233-RB, transcript variant B (CG17233), mRNA 
0   11  NM_168836.1  CG17233-RA, transcript variant A (CG17233), mRNA 
0   10  NM_142444.1  CG18599-RA (CG18599), mRNA 
0   10  NM_167239.2  CG32677-RA (CG32677), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.