National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11081R-1 
 Symbol plexA  Full Name plexin A 
 CG No CG11081  Old CG No CG11081 
 Synonyms PlexA1, PlexA, Plex1, CG11081, DPlexA, D-Plex A, BcDNA:GM05237, plexA 
 Accession No (Link to NCBI) NM_079898.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCGAGGACAGGTTGTCAAACCC 
 Primer Seq. 3'
aatctagaggtaccTACGGTTGAGGAGTTGGCATC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CGAGGACAGG TTGTCAAACC CTGGCAGCAA ATATATGGTC TGACAAGACG ACTGCGCAAA 
0061 ATGAGCCGAT AAATTTGACT AATGCAAATG CACCGATAAA GAATGCAAAG AATCTAAATT 
0121 CTACGATTAC AAATGTAGCT GCGTTTGACA CCAAATTGAA TCACCTATTA GTGGACACCA 
0181 TTACTGGACG AGTCTTCGTT GGTGGTGTTA ACAGGTTGTA TCAGTTGTCG CCTGATTTGG 
0241 AGCTTTCCGA AACTGTGAAA ACGGGGCCTC AAAATGATTC CGTCGAGTGT AGCATTCTTG 
0301 ATTGTCCATT AAATGCAGTT CGCAGTCCGA CGGACAATTA TAATAAGGTC TTGCTCATTG 
0361 ATCGTGCAAC TTCAAGACTT ATTGCGTGTG GATCACTATT TCAAGGTACA TGCACAGTTC 
0421 GTAATCTTCA AAATGTCAGC ATAATTGAGC ATGAAGTTCC TGATGCTGTT GTGGCTAATG 
0481 ATGCCAACTC CTCAACCGTA  
 in silico PCR Fragment
0001 CGAGGACAGG TTGTCAAACC CTGGCAGCAA ATATATGGTC TGACAAGACG ACTGCGCAAA 
0061 ATGAGCCGAT AAATTTGACT AATGCAAATG CACCGATAAA GAATGCAAAG AATCTGAATT 
0121 CTACGATTAC AAATGTAGCT GCGTTTGACA CCAAATTGAA TCACCTATTA GTGGACACCA 
0181 TTACTGGACG AGTCTTCGTT GGTGGTGTTA ACAGGTTGTA TCAGTTGTCG CCTGATTTGG 
0241 AGCTTTCCGA AACTGTGAAA ACGGGGCCTC AAAATGATTC CGTCGAGTGT AGCATTCTTG 
0301 ATTGTCCATT AAATGCAGTT CGCAGTCCGA CGGACAATTA TAATAAGGTC TTGCTCATTG 
0361 ATCGTGCAAC TTCAAGACTT ATTGCGTGTG GATCACTATT TCAAGGTACA TGCACAGTTC 
0421 GTAATCTTCA AAATGTCAGC ATAATTGAGC ATGAAGTTCC TGATGCTGTT GTGGCTAATG 
0481 ATGCCAACTC CTCAACCGTA  
 Assemble Data

11081R-1.IR_full       1   CGAGGACAGGTTGTCAAACCCTGGCAGCAAATATATGGTCTGACAAGACGACTGCGCAAA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11081R-1.in silico     1   CGAGGACAGGTTGTCAAACCCTGGCAGCAAATATATGGTCTGACAAGACGACTGCGCAAA 60


11081R-1.IR_full       61  ATGAGCCGATAAATTTGACTAATGCAAATGCACCGATAAAGAATGCAAAGAATCTAAATT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
11081R-1.in silico     61  ATGAGCCGATAAATTTGACTAATGCAAATGCACCGATAAAGAATGCAAAGAATCTGAATT 120


11081R-1.IR_full       121 CTACGATTACAAATGTAGCTGCGTTTGACACCAAATTGAATCACCTATTAGTGGACACCA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11081R-1.in silico     121 CTACGATTACAAATGTAGCTGCGTTTGACACCAAATTGAATCACCTATTAGTGGACACCA 180


11081R-1.IR_full       181 TTACTGGACGAGTCTTCGTTGGTGGTGTTAACAGGTTGTATCAGTTGTCGCCTGATTTGG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11081R-1.in silico     181 TTACTGGACGAGTCTTCGTTGGTGGTGTTAACAGGTTGTATCAGTTGTCGCCTGATTTGG 240


11081R-1.IR_full       241 AGCTTTCCGAAACTGTGAAAACGGGGCCTCAAAATGATTCCGTCGAGTGTAGCATTCTTG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11081R-1.in silico     241 AGCTTTCCGAAACTGTGAAAACGGGGCCTCAAAATGATTCCGTCGAGTGTAGCATTCTTG 300


11081R-1.IR_full       301 ATTGTCCATTAAATGCAGTTCGCAGTCCGACGGACAATTATAATAAGGTCTTGCTCATTG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11081R-1.in silico     301 ATTGTCCATTAAATGCAGTTCGCAGTCCGACGGACAATTATAATAAGGTCTTGCTCATTG 360


11081R-1.IR_full       361 ATCGTGCAACTTCAAGACTTATTGCGTGTGGATCACTATTTCAAGGTACATGCACAGTTC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11081R-1.in silico     361 ATCGTGCAACTTCAAGACTTATTGCGTGTGGATCACTATTTCAAGGTACATGCACAGTTC 420


11081R-1.IR_full       421 GTAATCTTCAAAATGTCAGCATAATTGAGCATGAAGTTCCTGATGCTGTTGTGGCTAATG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11081R-1.in silico     421 GTAATCTTCAAAATGTCAGCATAATTGAGCATGAAGTTCCTGATGCTGTTGTGGCTAATG 480


11081R-1.IR_full       481 ATGCCAACTCCTCAACCGTA 500
                           ||||||||||||||||||||
11081R-1.in silico     481 ATGCCAACTCCTCAACCGTA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079898.2  CG11081-RA, transcript variant A (plexA), mRNA 
100   482  NM_166806.2  CG11081-RD, transcript variant D (plexA), mRNA 
100   482  NM_001038715.1  CG11081-RE, transcript variant E (plexA), mRNA 
0   NM_080165.1  CG18211-RA (betaTry), mRNA 
0   NM_137730.2  CG30387-RA, transcript variant A (CG30387), mRNA 
0   NM_170563.1  CG1815-RB, transcript variant B (CG1815), mRNA 
0   NM_143624.2  CG1815-RC, transcript variant C (CG1815), mRNA 
0   NM_170562.1  CG1815-RA, transcript variant A (CG1815), mRNA 
0   NM_137248.2  CG8435-RA (CG8435), mRNA 
0   NM_142062.1  CG14363-RA (CG14363), mRNA 
0   NM_001014610.1  CG33546-RB, transcript variant B (gfzf), mRNA 
0   NM_169935.1  CG31191-RA (CG31191), mRNA 
0   NM_078509.2  CG3929-RA (dx), mRNA 
0   NM_142524.2  CG6040-RA (CG6040), mRNA 
0   NM_140114.1  CG14164-RA (CG14164), mRNA 
0   10  NM_166428.2  CG30389-RB, transcript variant B (CG30389), mRNA 
0   10  NM_137712.3  CG30389-RC, transcript variant C (CG30389), mRNA 
0   10  NM_137711.3  CG30389-RA, transcript variant A (CG30389), mRNA 
0   NM_137474.3  CG15066-RA (IM23), mRNA 
0   NM_138190.1  CG1233-RB, transcript variant B (CG1233), mRNA 
0   NM_167833.1  CG1233-RA, transcript variant A (CG1233), mRNA 
0   NM_079869.2  CG1528-RA, transcript variant A (gammaCop), mRNA 
0   NM_170553.1  CG1528-RB, transcript variant B (gammaCop), mRNA 
0   NM_166289.1  CG5186-RB, transcript variant B (slim), mRNA 
0   NM_079058.2  CG5186-RA, transcript variant A (slim), mRNA 
0   11  NM_168837.1  CG17233-RC, transcript variant C (CG17233), mRNA 
0   11  NM_140939.2  CG17233-RB, transcript variant B (CG17233), mRNA 
0   11  NM_168836.1  CG17233-RA, transcript variant A (CG17233), mRNA 
0   10  NM_142444.1  CG18599-RA (CG18599), mRNA 
0   10  NM_167239.2  CG32677-RA (CG32677), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.