National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11037R-4 
 Symbol CG11037  Full Name CG11037 
 CG No CG11037  Old CG No CG11037 
 Synonyms SP191, CG11037 
 Accession No (Link to NCBI) NM_141015.1 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico      1   TGCGTGCTGGCTTGCACTTTAGTTTCGACCCAAGTATATGGCCAAGAACAGGAGAAAAT 59

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  TGTGCTTTCCCTGCCGGATGAAAGTGGTCAACCGGGCAAAAATCTCACTCTCGATGTGGC 119

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 ACAGCTGGCCAAGATAGTTCTTCCATCACCACATGAAACTCGCGTAATTGGCGGCCATGT 179

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GACCACAAATGCCAAGTTGGGAGGATACCTAACAGCCTTGCTTTATGAAGACGATTTTGT 239

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TTGTGGCGGTACATTGCTCAACGAAAACATCGTCCTGACGGCGGCTCACTGTTTTCTGGG 299

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TCGAATGAAGGCGAGCGAATGGATTGTGGCTGCCGGCATTTCGAATCTCAATCAAAAGGG 359

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TATTCGACGCCATGTTAAGGACTTCATCCTGTCCGAGCAATTTCGAGAGGACGACATGAA 419

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TATGGATGTAGCAGTGGTACTGCTGAAAACTCCATTGAAGGCTAAAAACATCGGAACACT 479

11037R-4.IR_full       481 GAGCTTATGTTCGGTGAGNC 499
                           |||||||||||||||||| | silico     481 GAGCTTATGTTCGGTGAGCC 499

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_141015.1  CG11037-RA (CG11037), mRNA 
0   NM_134838.1  CG18641-RA (CG18641), mRNA 
0   NM_137516.1  CG15071-RA (CG15071), mRNA 
0   NM_136522.1  CG14760-RA (CG14760), mRNA 
0   NM_168321.1  CG10537-RC, transcript variant C (Rdl), mRNA 
0   NM_079267.2  CG10537-RA, transcript variant A (Rdl), mRNA 
0   NM_168322.1  CG10537-RB, transcript variant B (Rdl), mRNA 
0   NM_134929.2  CG3254-RA (pgant2), mRNA 
0   NM_140745.1  CG6052-RA (CG6052), mRNA 
0   NM_130617.2  CG4281-RA (CG4281), mRNA 
0   NM_143522.2  CG9747-RA (CG9747), mRNA 
0   NM_138195.2  CG12169-RA (CG12169), mRNA 
0   NM_137289.1  CG7813-RA (CG7813), mRNA 
0   NM_142446.2  CG7142-RA (CG7142), mRNA 
0   13  12  NM_141016.1  CG10587-RA (CG10587), mRNA 
0   16  NM_141013.1  CG10586-RA (CG10586), mRNA 
0   NM_142332.1  CG18213-RA (CG18213), mRNA 
0   NM_169748.1  CG31269-RA (CG31269), mRNA 
0   NM_132016.1  CG15778-RA (CG15778), mRNA 
0   NM_058149.3  CG3352-RA (ft), mRNA 
0   NM_141910.1  CG3916-RA (CG3916), mRNA 
0   NM_058085.4  CG9765-RC, transcript variant C (tacc), mRNA 
0   NM_176401.1  CG9765-RD, transcript variant D (tacc), mRNA 
0   NM_058086.2  CG9765-RA, transcript variant A (tacc), mRNA 
0   NM_169016.1  CG9765-RB, transcript variant B (tacc), mRNA 
0   NM_166467.2  CG30284-RB, transcript variant B (CG30284), mRNA 
0   NM_166468.2  CG30284-RA, transcript variant A (CG30284), mRNA 
0   NM_133068.2  CG6361-RA (CG6361), mRNA 
0   NM_080018.1  CG6890-RA (Tollo), mRNA 
0   NM_206780.1  CG6023-RB, transcript variant B (CG6023), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.