National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11037R-1 
 Symbol CG11037  Full Name CG11037 
 CG No CG11037  Old CG No CG11037 
 Synonyms SP191, CG11037 
 Accession No (Link to NCBI) NM_141015.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCTGCGTGCTGGCTTGCACTTT 
 Primer Seq. 3'
aatctagaggtaccGGCTCACCGAACATAAGCTCA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 NTGCGTGCTG GCTTGCACTT TAGTTTCGAC CCAAGTATAT GGCCAAGAAC AGGAGAAAAT 
0061 TGTGCTTTCC CTGCCGGATG AAAGTGGTCA ACCGGGCAAA AATCTCACTC TCGATGTGGC 
0121 ACAGCTGGCC AAGATAGTTC TTCCATCACC ACATGAAACT CGCGTAATTG GCGGCCATGT 
0181 GACCACAAAT GCCAAGTTGG GAGGATACCT AACAGCCTTG CTTTATGAAG ACGATTTTGT 
0241 TTGTGGCGGT ACATTGCTCA ACGAAAACAT CGTCCTGACG GCGGCTCACT GTTTTCTGGG 
0301 TCGAATGAAG GCGAGCGAAT GGATTGTGGC TGCCGGCATT TCGAATCTCA ATCAAAAGGG 
0361 TATTCGACGC CATGTTAAGG ACTTCATCCT GTCCGAGCAA TTTCGAGAGG ACGACATGAA 
0421 TATGGATGTA GCAGTGGTAC TGCTGAAAAC TCCATTGAAG GCTAAAAACA TCGGAACACT 
0481 GAGCTTATGT TCGGTGAGNC  
 in silico PCR Fragment
0001 CTGCGTGCTG GCTTGCACTT TAGTTTCGAC CCAAGTATAT GGCCAAGAAC AGGAGAAAAT 
0061 TGTGCTTTCC CTGCCGGATG AAAGTGGTCA ACCGGGCAAA AATCTCACTC TCGATGTGGC 
0121 ACAGCTGGCC AAGATAGTTC TTCCATCACC ACATGAAACT CGCGTAATTG GCGGCCATGT 
0181 GACCACAAAT GCCAAGTTGG GAGGATACCT AACAGCCTTG CTTTATGAAG ACGATTTTGT 
0241 TTGTGGCGGT ACATTGCTCA ACGAAAACAT CGTCCTGACG GCGGCTCACT GTTTTCTGGG 
0301 TCGAATGAAG GCGAGCGAAT GGATTGTGGC TGCCGGCATT TCGAATCTCA ATCAAAAGGG 
0361 TATTCGACGC CATGTTAAGG ACTTCATCCT GTCCGAGCAA TTTCGAGAGG ACGACATGAA 
0421 TATGGATGTA GCAGTGGTAC TGCTGAAAAC TCCATTGAAG GCTAAAAACA TCGGAACACT 
0481 GAGCTTATGT TCGGTGAGCC  
 Assemble Data

11037R-1.IR_full        1   TGCGTGCTGGCTTGCACTTTAGTTTCGACCCAAGTATATGGCCAAGAACAGGAGAAAAT 59
                            |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11037R-1.in silico      1   TGCGTGCTGGCTTGCACTTTAGTTTCGACCCAAGTATATGGCCAAGAACAGGAGAAAAT 59


11037R-1.IR_full       61  TGTGCTTTCCCTGCCGGATGAAAGTGGTCAACCGGGCAAAAATCTCACTCTCGATGTGGC 119
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11037R-1.in silico     61  TGTGCTTTCCCTGCCGGATGAAAGTGGTCAACCGGGCAAAAATCTCACTCTCGATGTGGC 119


11037R-1.IR_full       121 ACAGCTGGCCAAGATAGTTCTTCCATCACCACATGAAACTCGCGTAATTGGCGGCCATGT 179
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11037R-1.in silico     121 ACAGCTGGCCAAGATAGTTCTTCCATCACCACATGAAACTCGCGTAATTGGCGGCCATGT 179


11037R-1.IR_full       181 GACCACAAATGCCAAGTTGGGAGGATACCTAACAGCCTTGCTTTATGAAGACGATTTTGT 239
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11037R-1.in silico     181 GACCACAAATGCCAAGTTGGGAGGATACCTAACAGCCTTGCTTTATGAAGACGATTTTGT 239


11037R-1.IR_full       241 TTGTGGCGGTACATTGCTCAACGAAAACATCGTCCTGACGGCGGCTCACTGTTTTCTGGG 299
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11037R-1.in silico     241 TTGTGGCGGTACATTGCTCAACGAAAACATCGTCCTGACGGCGGCTCACTGTTTTCTGGG 299


11037R-1.IR_full       301 TCGAATGAAGGCGAGCGAATGGATTGTGGCTGCCGGCATTTCGAATCTCAATCAAAAGGG 359
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11037R-1.in silico     301 TCGAATGAAGGCGAGCGAATGGATTGTGGCTGCCGGCATTTCGAATCTCAATCAAAAGGG 359


11037R-1.IR_full       361 TATTCGACGCCATGTTAAGGACTTCATCCTGTCCGAGCAATTTCGAGAGGACGACATGAA 419
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11037R-1.in silico     361 TATTCGACGCCATGTTAAGGACTTCATCCTGTCCGAGCAATTTCGAGAGGACGACATGAA 419


11037R-1.IR_full       421 TATGGATGTAGCAGTGGTACTGCTGAAAACTCCATTGAAGGCTAAAAACATCGGAACACT 479
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11037R-1.in silico     421 TATGGATGTAGCAGTGGTACTGCTGAAAACTCCATTGAAGGCTAAAAACATCGGAACACT 479


11037R-1.IR_full       481 GAGCTTATGTTCGGTGAGNC 499
                           |||||||||||||||||| |
11037R-1.in silico     481 GAGCTTATGTTCGGTGAGCC 499

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_141015.1  CG11037-RA (CG11037), mRNA 
0   NM_134838.1  CG18641-RA (CG18641), mRNA 
0   NM_137516.1  CG15071-RA (CG15071), mRNA 
0   NM_136522.1  CG14760-RA (CG14760), mRNA 
0   NM_168321.1  CG10537-RC, transcript variant C (Rdl), mRNA 
0   NM_079267.2  CG10537-RA, transcript variant A (Rdl), mRNA 
0   NM_168322.1  CG10537-RB, transcript variant B (Rdl), mRNA 
0   NM_134929.2  CG3254-RA (pgant2), mRNA 
0   NM_140745.1  CG6052-RA (CG6052), mRNA 
0   NM_130617.2  CG4281-RA (CG4281), mRNA 
0   NM_143522.2  CG9747-RA (CG9747), mRNA 
0   NM_138195.2  CG12169-RA (CG12169), mRNA 
0   NM_137289.1  CG7813-RA (CG7813), mRNA 
0   NM_142446.2  CG7142-RA (CG7142), mRNA 
0   13  12  NM_141016.1  CG10587-RA (CG10587), mRNA 
0   16  NM_141013.1  CG10586-RA (CG10586), mRNA 
0   NM_142332.1  CG18213-RA (CG18213), mRNA 
0   NM_169748.1  CG31269-RA (CG31269), mRNA 
0   NM_132016.1  CG15778-RA (CG15778), mRNA 
0   NM_058149.3  CG3352-RA (ft), mRNA 
0   NM_141910.1  CG3916-RA (CG3916), mRNA 
0   NM_058085.4  CG9765-RC, transcript variant C (tacc), mRNA 
0   NM_176401.1  CG9765-RD, transcript variant D (tacc), mRNA 
0   NM_058086.2  CG9765-RA, transcript variant A (tacc), mRNA 
0   NM_169016.1  CG9765-RB, transcript variant B (tacc), mRNA 
0   NM_166467.2  CG30284-RB, transcript variant B (CG30284), mRNA 
0   NM_166468.2  CG30284-RA, transcript variant A (CG30284), mRNA 
0   NM_133068.2  CG6361-RA (CG6361), mRNA 
0   NM_080018.1  CG6890-RA (Tollo), mRNA 
0   NM_206780.1  CG6023-RB, transcript variant B (CG6023), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.