National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11030R-3 
 Symbol CG11030  Full Name CG11030 
 CG No CG11030  Old CG No CG11030 
 Synonyms CG11030 
 Accession No (Link to NCBI) NM_135112.1 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees larval lethal 
 Map Viewer
 Reference
[Please submit your publication]
Ohhara Y, Nakamura A, Kato Y, Yamakawa-Kobayashi K.
Chaperonin TRiC/CCT supports mitotic exit and entry into endocycle in Drosophila.
PLoS Genet. (2019) 15(4) e1008121 [ PubMed ID = 31034473 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCAGGCGATTCAGTTGCTCGGG 
 Primer Seq. 3'
aatctagaggtaccGCTTTCCGGGGCATTTTCGCT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CAGGCGATTC AGTTGCTCGG GGAGATGAAC AGCAATGTGA AACAGGTGAC TGACTTGGTG 
0061 GAGGGCATGC TGCAGCGAGT CAAGCGAGGC GAAGCTAACC ACAGAGTACG GCCTGAGCTT 
0121 TCTGGAAGTG AAGTACCACA TGCTACTGGA CTACTTGATC AATCTGACAT ATGTGGTGCT 
0181 GCgNAAATGC TCCGGCGAGA CCATTGAGGG TGATCCCTCC ATCGAACGTC TGATCGAGAT 
0241 TCGCACTGTG CTGGAGAAGA TTCGGCCCAT AGACCACAAG CTACGCTATC AGATTGACAA 
0301 ACTGGTAAAG ACAGCCACCA CTGGCGTCTC AAGCAGTACG GATCCCATAC TTTACAAACC 
0361 CAACCCAGAT GATATGATGA GCAGCGCAGG CGGAGCAGGC CGAGATGAGG ATGATGGAGA 
0421 AGATGACAGC GATGAGGAGG ACGAGGACGA CGATGAGGAG GATGAGGACG AGGCCGGCGC 
0481 AGCGAAAATG CCCCGGAAAG C 
 in silico PCR Fragment
0001 CAGGCGATTC AGTTGCTCGG GGAGATGAAC AGCAATGTGA AACAGGTGAC TGACTTGGTG 
0061 GAGGGCATGC TGCAGCGAGT CAAGCGAGGC G-AGCTAACC ACAGAGTACG GCCTGAGCTT 
0121 TCTGGAAGTG AAGTACCACA TGCTACTGGA CTACTTGATC AATCTGACAT ATGTGGTGCT 
0181 GCGCAAATGC TCCGGCGAGA CCATTGAGGG TGATCCCTCC ATCGAACGTC TGATCGAGAT 
0241 TCGCACTGTG CTGGAGAAGA TTCGGCCCAT AGACCACAAG CTACGCTATC AGATTGACAA 
0301 ACTGGTAAAG ACAGCCACCA CTGGCGTCTC AAGCAGTACG GATCCCATAC TTTACAAACC 
0361 CAACCCAGAT GATATGATGA GCAGCGCAGG CGGAGCAGGC CGAGATGAGG ATGATGGAGA 
0421 AGATGACAGC GATGAGGAGG ACGAGGACGA CGATGAGGAG GATGAGGACG AGGCCGGCGC 
0481 AGCGAAAATG CCCCGGAAAG C 
 Assemble Data

11030R-3.IR_full       1   CAGGCGATTCAGTTGCTCGGGGAGATGAACAGCAATGTGAAACAGGTGACTGACTTGGTG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11030R-3.in silico     1   CAGGCGATTCAGTTGCTCGGGGAGATGAACAGCAATGTGAAACAGGTGACTGACTTGGTG 60


11030R-3.IR_full       61  GAGGGCATGCTGCAGCGAGTCAAGCGAGGCGAAGCTAACCACAGAGTACGGCCTGAGCTT 120
                           ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||
11030R-3.in silico     61  GAGGGCATGCTGCAGCGAGTCAAGCGAGGCG-AGCTAACCACAGAGTACGGCCTGAGCTT 120


11030R-3.IR_full       121 TCTGGAAGTGAAGTACCACATGCTACTGGACTACTTGATCAATCTGACATATGTGGTGCT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11030R-3.in silico     121 TCTGGAAGTGAAGTACCACATGCTACTGGACTACTTGATCAATCTGACATATGTGGTGCT 180


11030R-3.IR_full       181 GCGNAAATGCTCCGGCGAGACCATTGAGGGTGATCCCTCCATCGAACGTCTGATCGAGAT 240
                           ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11030R-3.in silico     181 GCGCAAATGCTCCGGCGAGACCATTGAGGGTGATCCCTCCATCGAACGTCTGATCGAGAT 240


11030R-3.IR_full       241 TCGCACTGTGCTGGAGAAGATTCGGCCCATAGACCACAAGCTACGCTATCAGATTGACAA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11030R-3.in silico     241 TCGCACTGTGCTGGAGAAGATTCGGCCCATAGACCACAAGCTACGCTATCAGATTGACAA 300


11030R-3.IR_full       301 ACTGGTAAAGACAGCCACCACTGGCGTCTCAAGCAGTACGGATCCCATACTTTACAAACC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11030R-3.in silico     301 ACTGGTAAAGACAGCCACCACTGGCGTCTCAAGCAGTACGGATCCCATACTTTACAAACC 360


11030R-3.IR_full       361 CAACCCAGATGATATGATGAGCAGCGCAGGCGGAGCAGGCCGAGATGAGGATGATGGAGA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11030R-3.in silico     361 CAACCCAGATGATATGATGAGCAGCGCAGGCGGAGCAGGCCGAGATGAGGATGATGGAGA 420


11030R-3.IR_full       421 AGATGACAGCGATGAGGAGGACGAGGACGACGATGAGGAGGATGAGGACGAGGCCGGCGC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11030R-3.in silico     421 AGATGACAGCGATGAGGAGGACGAGGACGACGATGAGGAGGATGAGGACGAGGCCGGCGC 480


11030R-3.IR_full       481 AGCGAAAATGCCCCGGAAAGC 501
                           |||||||||||||||||||||
11030R-3.in silico     481 AGCGAAAATGCCCCGGAAAGC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  22  NM_135112.1  CG11030-RA (CG11030), mRNA 
1.03   19  69  NM_135392.3  CG13096-RA (CG13096), mRNA 
0.62   12  30  NM_001043220.1  CG34127-RA (CG34127), mRNA 
0.41   16  22  NM_166984.1  CG13316-RC, transcript variant C (Mnt), mRNA 
0.41   16  22  NM_166983.1  CG13316-RA, transcript variant A (Mnt), mRNA 
0.41   16  22  NM_130715.2  CG13316-RB, transcript variant B (Mnt), mRNA 
0.41   10  NM_168131.1  CG5505-RA, transcript variant A (mule), mRNA 
0.41   10  NM_168132.1  CG5505-RD, transcript variant D (mule), mRNA 
0.41   10  NM_139729.2  CG5505-RE, transcript variant E (mule), mRNA 
0.41   10  NM_168135.1  CG5505-RB, transcript variant B (mule), mRNA 
0.41   10  NM_168133.1  CG5505-RF, transcript variant F (mule), mRNA 
0.41   10  NM_168134.1  CG5505-RC, transcript variant C (mule), mRNA 
0.2   19  36  107  NM_132445.1  CG1567-RA (C901), mRNA 
0.2   14  37  125  NM_080025.1  CG11387-RA, transcript variant A (ct), mRNA 
0.2   32  91  NM_167130.1  CG11387-RB, transcript variant B (ct), mRNA 
0.2   11  11  NM_140649.2  CG17286-RA (CG17286), mRNA 
0.2   23  NM_135651.2  CG4751-RA (CG4751), mRNA 
0.2   38  NM_001014722.1  CG12212-RB, transcript variant B (peb), mRNA 
0.2   38  NM_057326.4  CG12212-RA, transcript variant A (peb), mRNA 
0.2   NM_168749.1  CG32187-RA (CG32187), mRNA 
0   10  58  NM_134490.2  CG12238-RA (l(1)G0084), mRNA 
0   26  45  NM_137047.2  CG6197-RA (CG6197), mRNA 
0   20  15  NM_135369.1  CG14273-RA (CG14273), mRNA 
0   39  101  NM_132412.1  CG9817-RA (CG9817), mRNA 
0   27  85  NM_143226.1  CG5467-RA (CG5467), mRNA 
0   18  31  NM_142899.1  CG10152-RA (beat-IV), mRNA 
0   16  49  NM_057780.2  CG5330-RA (Nap1), mRNA 
0   13  12  NM_057252.3  CG3758-RA (esg), mRNA 
0   29  NM_165156.1  CG5813-RB, transcript variant B (chif), mRNA 
0   29  NM_078859.2  CG5813-RA, transcript variant A (chif), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.