National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11030R-2 
 Symbol CG11030  Full Name CG11030 
 CG No CG11030  Old CG No CG11030 
 Synonyms CG11030 
 Accession No (Link to NCBI) NM_135112.1 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CAGGCGATTCAGTTGCTCGGGGAGATGAACAGCAATGTGAAACAGGTGACTGACTTGGTG 60

                           ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| silico     61  GAGGGCATGCTGCAGCGAGTCAAGCGAGGCG-AGCTAACCACAGAGTACGGCCTGAGCTT 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TCTGGAAGTGAAGTACCACATGCTACTGGACTACTTGATCAATCTGACATATGTGGTGCT 180

                           ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GCGCAAATGCTCCGGCGAGACCATTGAGGGTGATCCCTCCATCGAACGTCTGATCGAGAT 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TCGCACTGTGCTGGAGAAGATTCGGCCCATAGACCACAAGCTACGCTATCAGATTGACAA 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 ACTGGTAAAGACAGCCACCACTGGCGTCTCAAGCAGTACGGATCCCATACTTTACAAACC 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CAACCCAGATGATATGATGAGCAGCGCAGGCGGAGCAGGCCGAGATGAGGATGATGGAGA 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 AGATGACAGCGATGAGGAGGACGAGGACGACGATGAGGAGGATGAGGACGAGGCCGGCGC 480

11030R-2.IR_full       481 AGCGAAAATGCCCCGGAAAGC 501
                           ||||||||||||||||||||| silico     481 AGCGAAAATGCCCCGGAAAGC 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  22  NM_135112.1  CG11030-RA (CG11030), mRNA 
1.03   19  69  NM_135392.3  CG13096-RA (CG13096), mRNA 
0.62   12  30  NM_001043220.1  CG34127-RA (CG34127), mRNA 
0.41   16  22  NM_166984.1  CG13316-RC, transcript variant C (Mnt), mRNA 
0.41   16  22  NM_166983.1  CG13316-RA, transcript variant A (Mnt), mRNA 
0.41   16  22  NM_130715.2  CG13316-RB, transcript variant B (Mnt), mRNA 
0.41   10  NM_168131.1  CG5505-RA, transcript variant A (mule), mRNA 
0.41   10  NM_168132.1  CG5505-RD, transcript variant D (mule), mRNA 
0.41   10  NM_139729.2  CG5505-RE, transcript variant E (mule), mRNA 
0.41   10  NM_168135.1  CG5505-RB, transcript variant B (mule), mRNA 
0.41   10  NM_168133.1  CG5505-RF, transcript variant F (mule), mRNA 
0.41   10  NM_168134.1  CG5505-RC, transcript variant C (mule), mRNA 
0.2   19  36  107  NM_132445.1  CG1567-RA (C901), mRNA 
0.2   14  37  125  NM_080025.1  CG11387-RA, transcript variant A (ct), mRNA 
0.2   32  91  NM_167130.1  CG11387-RB, transcript variant B (ct), mRNA 
0.2   11  11  NM_140649.2  CG17286-RA (CG17286), mRNA 
0.2   23  NM_135651.2  CG4751-RA (CG4751), mRNA 
0.2   38  NM_001014722.1  CG12212-RB, transcript variant B (peb), mRNA 
0.2   38  NM_057326.4  CG12212-RA, transcript variant A (peb), mRNA 
0.2   NM_168749.1  CG32187-RA (CG32187), mRNA 
0   10  58  NM_134490.2  CG12238-RA (l(1)G0084), mRNA 
0   26  45  NM_137047.2  CG6197-RA (CG6197), mRNA 
0   20  15  NM_135369.1  CG14273-RA (CG14273), mRNA 
0   39  101  NM_132412.1  CG9817-RA (CG9817), mRNA 
0   27  85  NM_143226.1  CG5467-RA (CG5467), mRNA 
0   18  31  NM_142899.1  CG10152-RA (beat-IV), mRNA 
0   16  49  NM_057780.2  CG5330-RA (Nap1), mRNA 
0   13  12  NM_057252.3  CG3758-RA (esg), mRNA 
0   29  NM_165156.1  CG5813-RB, transcript variant B (chif), mRNA 
0   29  NM_078859.2  CG5813-RA, transcript variant A (chif), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.