National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 11029R-2 
 Symbol CG11029  Full Name CG11029 
 CG No CG11029  Old CG No CG11029 
 Synonyms CG11029 
 Accession No (Link to NCBI) NM_135111.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTCGCCTCTTGTGTCCGCGAAT 
 Primer Seq. 3'
aatctagaggtaccTTCAGGATGTTCGGCAGGGTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TCGCCTCTTG TGTCCGCGAA TCGGCGTGTC CGGCGACAAA ATCGATCCGA TCGCCTGCTG 
0061 GCCGACATCG GAGTACGTGC CCAGTCCTAC GATCCCCGTG TGCCGGAAAA TGGCATTCAG 
0121 CAGTACACCG ACATCGACCA GGATCTGCGC CATCTGTTCC TGAACACCAG GCAGACCACG 
0181 CTGAAATGGG CCCTTAACAA CATCGAGGCG CTGAGCAGTC GCGGCAGACG CGAGGGAAAG 
0241 CTCCAGGCTC CGGTGTCCAA GAAGGTGCCC TTCCTGTGTC CCACTAACAA CACACGCTCC 
0301 CCGAGTCCGC CCACTTCCAT AGAGCACCTC AGGCCGGGTG ATATTGACAT CATANGCTGC 
0361 CTTTGGCGAC TCCCTGTCCG CAGGCAACGG AATACTTTCC AACAATGCCA TCGACATGAT 
0421 CAACGAGTTC CGTGGTCTGA CCTTCTCCGG TGGCGGTCTg GNCAACTGGC GAAGATTCGT 
0481 CACCCTGCCG AACATCCTGA A 
 in silico PCR Fragment
0001 TCGCCTCTTG TGTCCGCGAA TCGGCGTGTC CGGCGACAAA ATCGATCCGA TCGCCTGCTG 
0061 GCCGACATCG GAGTACGTGC CCAGTCCTAC GATCCCCGTG TGCCGGAAAA TGGCATTCAG 
0121 CAGTACACCG ACATCGACCA GGATCTGCGC CATCTGTTCC TGAACACCAG GCAGACCACG 
0181 CTGAAATGGG CCCTTAACAA CATCGAGGCG CTGAGCAGTC GCGGCAGACG CGAGGGAAAG 
0241 CTCCAGGCTC CGGTGTCCAA GAAGGTGCCC TTCCTGTGTC CCACTAACAA CACACGCTCC 
0301 CCGAGTCCGC CCACTTCCAT AGAGCACCTC AGGCCGGGTG ATATTGACAT CATA-GCTGC 
0361 CTTTGGCGAC TCCCTGTCCG CAGGCAACGG AATACTTTCC AACAATGCCA TCGACATGAT 
0421 CAACGAGTTC CGTGGTCTGA CCTTCTCCGG TGGCGGTCTG GCCAACTGGC GAAGATTCGT 
0481 CACCCTGCCG AACATCCTGA A 
 Assemble Data

11029R-2.IR_full       1   TCGCCTCTTGTGTCCGCGAATCGGCGTGTCCGGCGACAAAATCGATCCGATCGCCTGCTG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11029R-2.in silico     1   TCGCCTCTTGTGTCCGCGAATCGGCGTGTCCGGCGACAAAATCGATCCGATCGCCTGCTG 60


11029R-2.IR_full       61  GCCGACATCGGAGTACGTGCCCAGTCCTACGATCCCCGTGTGCCGGAAAATGGCATTCAG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11029R-2.in silico     61  GCCGACATCGGAGTACGTGCCCAGTCCTACGATCCCCGTGTGCCGGAAAATGGCATTCAG 120


11029R-2.IR_full       121 CAGTACACCGACATCGACCAGGATCTGCGCCATCTGTTCCTGAACACCAGGCAGACCACG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11029R-2.in silico     121 CAGTACACCGACATCGACCAGGATCTGCGCCATCTGTTCCTGAACACCAGGCAGACCACG 180


11029R-2.IR_full       181 CTGAAATGGGCCCTTAACAACATCGAGGCGCTGAGCAGTCGCGGCAGACGCGAGGGAAAG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11029R-2.in silico     181 CTGAAATGGGCCCTTAACAACATCGAGGCGCTGAGCAGTCGCGGCAGACGCGAGGGAAAG 240


11029R-2.IR_full       241 CTCCAGGCTCCGGTGTCCAAGAAGGTGCCCTTCCTGTGTCCCACTAACAACACACGCTCC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11029R-2.in silico     241 CTCCAGGCTCCGGTGTCCAAGAAGGTGCCCTTCCTGTGTCCCACTAACAACACACGCTCC 300


11029R-2.IR_full       301 CCGAGTCCGCCCACTTCCATAGAGCACCTCAGGCCGGGTGATATTGACATCATANGCTGC 360
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
11029R-2.in silico     301 CCGAGTCCGCCCACTTCCATAGAGCACCTCAGGCCGGGTGATATTGACATCATA-GCTGC 360


11029R-2.IR_full       361 CTTTGGCGACTCCCTGTCCGCAGGCAACGGAATACTTTCCAACAATGCCATCGACATGAT 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
11029R-2.in silico     361 CTTTGGCGACTCCCTGTCCGCAGGCAACGGAATACTTTCCAACAATGCCATCGACATGAT 420


11029R-2.IR_full       421 CAACGAGTTCCGTGGTCTGACCTTCTCCGGTGGCGGTCTGGNCAACTGGCGAAGATTCGT 480
                           ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
11029R-2.in silico     421 CAACGAGTTCCGTGGTCTGACCTTCTCCGGTGGCGGTCTGGCCAACTGGCGAAGATTCGT 480


11029R-2.IR_full       481 CACCCTGCCGAACATCCTGAA 501
                           |||||||||||||||||||||
11029R-2.in silico     481 CACCCTGCCGAACATCCTGAA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135111.1  CG11029-RA (CG11029), mRNA 
0   NM_169805.3  CG7125-RD, transcript variant D (PKD), mRNA 
0   NM_169804.3  CG7125-RC, transcript variant C (PKD), mRNA 
0   NM_142453.3  CG7125-RA, transcript variant A (PKD), mRNA 
0   NM_169803.3  CG7125-RB, transcript variant B (PKD), mRNA 
0   NM_167540.1  CG32570-RA (CG32570), mRNA 
0   NM_165655.1  CG30344-RA (CG30344), mRNA 
0   NM_143626.2  CG2261-RA, transcript variant A (CstF-50), mRNA 
0   NM_170569.1  CG2261-RB, transcript variant B (CstF-50), mRNA 
0   NM_141365.2  CG1150-RA (Osi3), mRNA 
0   NM_143285.1  CG6051-RA (CG6051), mRNA 
0   NM_079725.2  CG7050-RA (Nrx-1), mRNA 
0   NM_135908.2  CG18482-RA (CG18482), mRNA 
0   NM_142246.2  CG4225-RA (CG4225), mRNA 
0   NM_057788.3  CG8396-RA (Ssb-c31a), mRNA 
0   NM_165913.1  CG8581-RB, transcript variant B (fra), mRNA 
0   NM_078992.2  CG8581-RA, transcript variant A (fra), mRNA 
0   NM_143446.2  CG1907-RA (CG1907), mRNA 
0   NM_132437.1  CG15207-RA (CG15207), mRNA 
0   NM_141703.1  CG12802-RA (CG12802), mRNA 
0   NM_080035.2  CG10753-RA (snRNP69D), mRNA 
0   10  NM_132005.1  CG15780-RA (CG15780), mRNA 
0   NM_134871.1  CG3131-RA (Duox), mRNA 
0   NM_132125.1  CG4536-RA (CG4536), mRNA 
0   NM_078773.2  CG31628-RA, transcript variant A (ade3), mRNA 
0   NM_130545.2  CG11411-RA (fs(1)N), mRNA 
0   NM_141244.2  CG14657-RB (CG14657), mRNA 
0   NM_140908.1  CG7570-RA (hale), mRNA 
0   NM_058068.3  CG3048-RA, transcript variant A (Traf1), mRNA 
0   NM_167726.1  CG1753-RB, transcript variant B (CG1753), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.